Placopterus thoracicus

(Olivier, 1795) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cleridae/Placopterus

At a glance

Occurrence records716

Data sources6

Biological traits0

DNA specimens39

eDNA detections38

Sources6 archives

Databases and archives Placopterus thoracicus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility716 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF716 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD39 specimens

01Narrative

Placopterus thoracicus is a species of checkered beetle in the family Cleridae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Placopterus thoracicus has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

46Tmostly conserved

67Gmostly conserved

79Gvariable

181Avariable

211Amostly conserved

217Amostly conserved

263Cmostly conserved

268Avariable

271Cmostly conserved

316Avariable

328Amostly conserved

340Cmostly conserved

364Cvariable

370Gmostly conserved

400Tmostly conserved

439Gmostly conserved

490Tmostly conserved

508Cmostly conserved

517Amostly conserved

526Tmostly conserved

622Gmostly conserved

628Tmostly conserved

631Amostly conserved

646Tvariable

TACTTTATATTTCATTTTCGGTGCTTGATCAGGAATAGTAGGTACTTCATTAAGATTATTAATTCGGTCAGAATTAGGGACACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes15

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Enoclerus rosmarussame family10.3%Cregya oculatasame family11.3%Haliplus laminatussame order12.0%Xestonotus lugubrissame order12.2%Pectotoma hoppingisame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type716 records

Wild obs. + sensor487

Museum / vouchered229

Origin

Native1

Range

Area of Occupancy AOO1 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 270≤1 km 80≤10 km 21>10 km 43

414 georeferenced · 73 without coordinates

Open the mapobservation + sensor487

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 2≤10 km 30>10 km 5

40 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence229

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	115
University of Guelphlocation not on record	40
Lexington, US	15
Philadelphia, US	7
New Haven, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Champaign, US	6
Lubbock, US	5
MAJClocation not on record	3
OSUClocation not on record	3
College Station, US	2
Espace pour la vielocation not on record	2
Natural History Museum of Utahlocation not on record	2
Cambridge, US	1
Biodiversity Institute of Ontariolocation not on record	1
University of Central Floridalocation not on record	1
University of Nebraska State Museumlocation not on record	1

17 institutions · 216 of 229 vouchered records shown · 13 without an institution code

09Environmental DNA38 detections

Where the DNA of Placopterus thoracicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

WetlandMixed habitatGrasslandRiparian ZoneTemperate mixed forestfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 13.2–21.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.6 °C 18.6–24.3

Min temp (night)13.7 °C 8.20–19.2

Precipitation84.3 mm/mo 81.0–94.8

Air humidity57.2 % 55.8–60.6

Moisture balance-60.7 mm/mo -77.2–-25.1

Vapour deficit888 Pa 676–1,063

Wind speed3.40 m/s 2.70–4.40

Cloud cover42.1 % 39.1–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)