Placomaronea candelarioides

Fungi/Ascomycota/Candelariomycetes/Candelariales/Candelariaceae/Placomaronea

At a glance

Occurrence records33

Data sources7

Biological traits0

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Placomaronea candelarioides's data was compiled from.

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Placomaronea candelarioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF535217.1 ↗478 bpArgentina

ACGT

AAGAGTAAGGGTCCTCTGGGCCCGACCTCCAACCCTTTGTCTACTTACCCCTGTTGCTTTGGCGGGCCCGCTGGGTCAAACCCCACCGCT …

Placomaronea candelarioides strain ARG227 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor2

Museum / vouchered31

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	13
Stockholm, SE	6
St. Paul, US	3
Berlin, DE	2
Uppsala, SE	2
Helsinki, FI	2
Bronx, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
ASUlocation not on record	1

9 institutions · 31 of 31 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Placomaronea candelarioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.