Placocarpus schaereri

(Fr.) Breuss · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Verrucariales/Verrucariaceae/Placocarpus

At a glance

Occurrence records360

Data sources8

Biological traits1

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Placocarpus schaereri's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF360 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Placocarpus schaereri is a species of saxicolous (rock-dwelling), areolate, and crustose lichen in the family Verrucariaceae. Found in Europe, it is the type species of genus Placocarpus. The lichen was first described scientifically in 1831 by Elias Magnus Fries, who called it Parmelia schaereri. The species epithet honours Swiss pastor and lichenologist Ludwig Schaerer. Othmar Breuss transferred it to the newly reinstated genus Placocarpus in 1985. Juvenile forms of Placocarpus schaereri are often parasitic on the lichen Protoparmeliopsis muralis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Placocarpus schaereri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEU006532.1 ↗905 bp

ACGT

AAGTCGTAACAAGGTTTTCGTCGCGACCCTCTGAAGCCTTTCACACAACGACTCTAATAAGATTGTGTGTAGTCCCTTTCACTATCGTTA …

Placocarpus schaereri voucher C. Gueidan 588 (MARSSJ) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type360 records

Wild obs. + sensor166

Museum / vouchered193

Other1

Origin

Native18

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 55≤1 km 38≤10 km 25>10 km 2

120 georeferenced · 46 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 9≤1 km 41≤10 km 89>10 km 3

142 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	72
TSBlocation not on record	29
Madison, US	9
Berlin, DE	9
Durham, US	8
CLUlocation not on record	7
Museo Achille Folettolocation not on record	7
GZUlocation not on record	7
Madrid, ES	6
MAlocation not on record	5
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	4
University of Gdansklocation not on record	4
Olocation not on record	3
Uppsala, SE	3
Barcelona, ES	2
Museo di Storia Naturale di Venezia Giancarlo Ligabue \| Natural History Museum of Venice Giancarlo Ligabuelocation not on record	1
Oskarshamn, SE	1
San Sebastián, ES	1
MNHWlocation not on record	1
PHlocation not on record	1
ASUlocation not on record	1
Bronx, US	1
MeiseBGlocation not on record	1
Helsinki, FI	1
València, ES	1
University of Hamburglocation not on record	1
Santa Barbara, US	1

27 institutions · 187 of 193 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Placocarpus schaereri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)