Placobdella parasitica

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Annelida/Clitellata/Rhynchobdellida/Glossiphoniidae/Placobdella

At a glance

Occurrence records1 859

Data sources10

Biological traits0

DNA specimens118

eDNA detections121

Sources10 archives

Databases and archives Placobdella parasitica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 848 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI121 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics118 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.62 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS1 859 records

Environmental DNA1 datasets · 2 countries121 detections

DNA & barcodingBOLD118 specimens

Genome at a glanceGoaT616 Mbp

01Narrative

Placobdella parasitica is a species of leech found in North America. Leeches are habitual ectoparasites of vertebrates in aquatic environments. Placobdella parasitica is differentiated from other members of the genus Placobdella by its smooth dorsal surface, simple to complicated pigmentation, and abdomen with 8 to 12 stripes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding118 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Placobdella parasitica has left across the world's sequence archives.

At a glance

DNA specimens118

BINs11

Marker genes2

eDNA detections121

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

5Tmostly conserved

13Cmostly conserved

58Tmostly conserved

79Cmostly conserved

91Tmostly conserved

106Tmostly conserved

112Amostly conserved

140Tvariable

142Avariable

157Tmostly conserved

181Gmostly conserved

184Gvariable

196Amostly conserved

206Tmostly conserved

214Tmostly conserved

217Amostly conserved

220Tvariable

226Tmostly conserved

235Cmostly conserved

244Tmostly conserved

250Tmostly conserved

251Tmostly conserved

262Gmostly conserved

283Tmostly conserved

287Tmostly conserved

295Cmostly conserved

301Tmostly conserved

302Tmostly conserved

307Gmostly conserved

313Gmostly conserved

316Gmostly conserved

322Amostly conserved

340Tmostly conserved

343Cvariable

347Tmostly conserved

373Gmostly conserved

397Cmostly conserved

400Cmostly conserved

406Cmostly conserved

412Tmostly conserved

418Amostly conserved

430Tmostly conserved

436Amostly conserved

442Cmostly conserved

457Tmostly conserved

463Cvariable

478Tmostly conserved

493Amostly conserved

511Gmostly conserved

526Cmostly conserved

538Gmostly conserved

539Tmostly conserved

547Avariable

557Tmostly conserved

562Amostly conserved

568Tmostly conserved

604Tmostly conserved

607Cmostly conserved

616Tmostly conserved

625Amostly conserved

631Amostly conserved

637Amostly conserved

640Tmostly conserved

646Cmostly conserved

653Cmostly conserved

AACATTATATTTCATATTTGGGGCATGATCAGCTATAGTTGGTACAGCAATAAGAATTATTATTCGTATTGAATTAGCCCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes6

BINs11

Most divergent pair7.3%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Placobdella cryptobranchiisame genus13.6%Hemiclepsis schrenckisame family13.7%Placobdella hollensissame genus14.4%Batracobdella paludosasame family14.6%Placobdella costatasame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Placobdella parasitica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size616 140 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Placobdella parasitica0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 859 records

Wild obs. + sensor1 131

Museum / vouchered728

Range

Area of Occupancy AOO4 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 641≤1 km 127≤10 km 50>10 km 137

955 georeferenced · 176 without coordinates

Open the mapobservation + sensor1 131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 2≤1 km 14≤10 km 79>10 km 14

109 georeferenced · 619 without coordinates

Open the institutions mapphysical evidence728

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	361
Washington, US	153
New Haven, US	72
Cambridge, US	36
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	35
München, DE	26
Chicago, US	19
Saint John, CA	6
Harold Winfred Manter Laboratory of Parasitologylocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 712 of 728 vouchered records shown · 5 without an institution code

09Environmental DNA121 detections

Where the DNA of Placobdella parasitica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found121

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 121 detections have coordinates

Open the map2 countries0

Stream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 12.6–17.4

Seasonal swing summer↔winter25.1 °C

Max temp (day)18.1 °C 17.3–21.4

Min temp (night)8.60 °C 8.20–14.6

Precipitation96.4 mm/mo 89.6–108

Air humidity57.0 % 55.8–60.7

Moisture balance6.80 mm/mo -33.6–11.8

Vapour deficit743 Pa 713–833

Wind speed2.80 m/s 2.60–5.60

Cloud cover44.0 % 38.1–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Placobdella parasitica

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type1 859 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 859 records