Pityrodia scabra — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Pityrodia

At a glance

Occurrence records9

Data sources6

Biological traits15

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Pityrodia scabra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pityrodia scabra là một loài thực vật có hoa trong họ Hoa môi. Loài này được A.S.George miêu tả khoa học đầu tiên năm 1967.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology3

Plant height1.05 m

Plant height max1.4 m

Plant height min0.7 m

Life cycle & reproduction5

Flowering timennnnnnnnnyyn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pityrodia scabra has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381187.1 ↗600 bp

ACGT

TGCAAAGCAGACCGCGAACACGTGATTAACAACACAGGGCCCGTGATGCGGGGGGAAACCTCCGATCTCGGCGCCACCCCCGCCGGCGCA …

Pityrodia scabra internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered9

Origin

Native2

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 1≤1 km 4≤10 km 3

8 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence9

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	2
Museo Entomologico de Leonlocation not on record	2
Kew, GB	1
Hobart, AU	1
Kensington, AU	1
Adelaide, AU	1
Canberra, AU	1

7 institutions · 9 of 9 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pityrodia scabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.