Pityrodia lepidota

(F.Muell.) E.Pritz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Pityrodia

At a glance

Occurrence records259

Data sources9

Biological traits15

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Pityrodia lepidota's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility259 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF259 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pityrodia lepidota is a flowering plant in the mint family Lamiaceae and is endemic to the south-west of Western Australia. It is a small, densely-branched shrub with small leaves and whitish, bell-shaped flowers. The entire plant, apart from the petals, is densely covered with small, circular scales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology3

Plant height0.45 m

Plant height max0.7 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering timeyyynnyyyyyyy

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition24 compounds

Compounds documented for Pityrodia lepidota across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives15

Spirostane steroids4

Furostane steroids $ Spirostane steroids3

Colensane and Clerodane diterpenoids1

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6S,6'S,7S,8R,9S,12S,13R,16S)-6'-methoxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5'-(hydroxymethyl)-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6S,6'S,7S,8R,9S,12S,13R,16S)-6'-methoxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(3S)-3-hydroxy-5-[[(1S,2S,3'R,4S,6R,7S,8R,9S,12S,13R,16S)-16-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,6'-oxane]-3'-yl]methoxy]-3-methyl-5-oxopentanoic acid	present	NPASS
(3S)-5-[[(1S,2S,3'R,4S,6R,7S,8R,9S,12S,13R,16S)-16-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,6'-oxane]-3'-yl]methoxy]-3-hydroxy-3-methyl-5-oxopentanoic acid	present	NPASS
(E)-3-(4-Hydroxyphenyl)propenoic acid (2S)-3-(beta-D-glucopyranosyloxy)-2-hydroxypropyl ester	present	NPASS
1,2-Diferuloyl-sn-glycerol	present	NPASS
[(2R)-2,3-dihydroxypropyl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	NPASS
[(2R)-2-hydroxy-3-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxypropyl] (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	NPASS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[(2R,3S,4S,5R,6R)-4-hydroxy-2-(hydroxymethyl)-6-[(1S,2S,4S,5'R,6S,6'S,7S,8R,9S,12S,13R,16S)-6'-methoxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxyoxan-2-yl]methyl acetate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pityrodia lepidota has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381185.1 ↗610 bp

ACGT

AACCTGCAAAGCAGACCGCGAACACGTGATTAACAACACAGGGGTCGCGGTACGGGTGGAAACCCCCGATCGCGGCGCCACCCCCGCCGG …

Pityrodia lepidota internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type259 records

Wild obs. + sensor10

Museum / vouchered249

Origin

Native20

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5≤10 km 1>10 km 2

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 38≤1 km 19≤10 km 138>10 km 16

211 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence249

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	124
Canberra, AU	34
Museo Entomologico de Leonlocation not on record	31
Adelaide, AU	25
Mount Annan, AU	20
Brisbane, AU	5
Kew, GB	4
Hobart, AU	2
BGPAlocation not on record	2
Palmerston, AU	2

10 institutions · 249 of 249 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pityrodia lepidota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)