Pityopsis aspera

(A.Gray) Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pityopsis

At a glance

Occurrence records615

Data sources9

Biological traits8

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Pityopsis aspera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF615 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Pityopsis aspera là một loài thực vật có hoa trong họ Cúc. Loài này được Small miêu tả khoa học đầu tiên năm 1933.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pityopsis aspera has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ892715.1 ↗629 bpUSA

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTACAACAACCATGCCAGGTTGATCGGGCATCCGTTCGATCCTCCTGGCACACCG …

Pityopsis aspera var. adenolepis isolate A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pityopsis aspera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · eflora

2n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C. 1977. Cytotaxonomy of Chrysopsis and Heterotheca (Compositae Astereae): A new interpretation of phylogeny. Canad. J. Bot. 55: 2503–2513.

n 182×CCDB · book-ipcn65 · CCDB · book-ipcn66

CCDB · book-ipcn65 — Smith 1965a

CCDB · book-ipcn66 — E.B.Smith1966a

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jones, A. G. & R. A. Smogor. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type615 records

Wild obs. + sensor236

Museum / vouchered379

Range

Area of Occupancy AOO1 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 136≤1 km 15≤10 km 8>10 km 25

184 georeferenced · 52 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 14≤1 km 72≤10 km 100>10 km 58

244 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence379

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	127
Bangkok, TH	58
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	31
Tall Timbers Research Stationlocation not on record	26
Jena Microbial Resource Collectionlocation not on record	17
Tampa, US	16
Miami, US	14
Bloomington, US	9
Valdosta State Universitylocation not on record	9
Jackson, US	7
Mississippi State, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
University of Stellenboschlocation not on record	6
Montréal, CA	5
Columbia, US	5
University of Southern Mississippilocation not on record	3
Dekalb, US	3
San Angelo, US	3
EL PASO, US	3
GAlocation not on record	3
Riverside, US	2
Moscow, US	2
Taipei, TW	2
Québec, CA	2
Tempe, US	1
Clemson, US	1
Asheville, US	1
Minia, EG	1
Saint Louis, US	1
AUAlocation not on record	1
Richmond, US	1
University of North Carolina at Pembrokelocation not on record	1
Columbus State Universitylocation not on record	1
Wuzhou, CN	1
Toronto, CA	1

35 institutions · 377 of 379 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Pityopsis aspera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 26.6–26.6

Seasonal swing summer↔winter19.2 °C

Max temp (day)31.8 °C

Min temp (night)22.2 °C

Precipitation103 mm/mo

Air humidity61.4 %

Moisture balance-46.0 mm/mo

Vapour deficit1,345 Pa

Wind speed1.90 m/s

Cloud cover26.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)