Pityeja histrionaria

(Herrich-Schäffer) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Pityeja

At a glance

Occurrence records632

Data sources7

Biological traits0

DNA specimens26

eDNA detections15

Sources7 archives

Databases and archives Pityeja histrionaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF632 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD26 specimens

01Narrative

Pityeja histrionaria is a moth of the family Geometridae first described by Gottlieb August Wilhelm Herrich-Schäffer in 1853. It is found in Central and South America, where it has been recorded from Costa Rica, Honduras, Ecuador and Venezuela. The larvae have been recorded feeding on Myrsine coriacea.Donnathebuffalo (November 8, 2014). "Pityeja histrionaria Herrich-Shäffer". Parasitoid-Caterpillar-Plant Interactions in the Americas. Retrieved April 7, 2019.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pityeja histrionaria has left across the world's sequence archives.

At a glance

DNA specimens26

BINs5

Marker genes1

eDNA detections15

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

10Cvariable

22Amostly conserved

28Amostly conserved

40Amostly conserved

50Tmostly conserved

67Amostly conserved

82Tvariable

85Amostly conserved

100Tmostly conserved

130Amostly conserved

133Tmostly conserved

160Amostly conserved

190Amostly conserved

193Tmostly conserved

211Amostly conserved

214Amostly conserved

217Amostly conserved

220Tvariable

223Cvariable

232Cvariable

235Tmostly conserved

238Tvariable

266Tmostly conserved

271Amostly conserved

274Tmostly conserved

283Tmostly conserved

295Amostly conserved

298Tmostly conserved

316Gvariable

334Tvariable

337Tvariable

340Tmostly conserved

343Tvariable

346Tmostly conserved

352Avariable

364Cvariable

367Tmostly conserved

368Amostly conserved

370Amostly conserved

385Tmostly conserved

400Amostly conserved

466Amostly conserved

505Tvariable

508Amostly conserved

547Tmostly conserved

553Avariable

556Gvariable

565Tmostly conserved

571Tmostly conserved

574Amostly conserved

586Cvariable

604Tmostly conserved

610Tmostly conserved

616Tvariable

619Tmostly conserved

634Tvariable

646Tmostly conserved

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes9

BINs5

Most divergent pair6.5%

N.AmericaS.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Epimecis puellariasame family5.8%Phrygionis platinatasame family6.2%Phrygionis moeschlerisame family6.4%Acrotomodes clotasame family6.4%Tephronia sepiariasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type632 records

Wild obs. + sensor455

Museum / vouchered177

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 208≤1 km 133≤10 km 23>10 km 9

373 georeferenced · 82 without coordinates

Open the mapobservation + sensor455

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 5

6 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	123
Uniwersytet Jagiellońskilocation not on record	45
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	3
New Haven, US	2
ZSMlocation not on record	1
Universidad de Sucre (UniSucre)location not on record	1
Bavarian State Collection of Zoologylocation not on record	1

7 institutions · 176 of 177 vouchered records shown · 1 without an institution code

09Environmental DNA15 detections

Where the DNA of Pityeja histrionaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 14.0–24.4

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.9 °C 17.2–28.2

Min temp (night)17.6 °C 10.3–21.1

Precipitation114 mm/mo 58.6–574

Air humidity68.4 % 59.1–70.1

Moisture balance-23.6 mm/mo -102–458

Vapour deficit914 Pa 480–1,078

Wind speed2.00 m/s 0.9–2.50

Cloud cover15.1 % 13.6–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)