Pittosporum undulatum
Vent. · speciesAt a glance
Occurrence records42 216
Data sources11
Biological traits71
DNA specimens15
eDNA detections12
Sources11 archives
Databases and archives Pittosporum undulatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 216 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources71 traits
Chemical compositionLOTUS · NPASS51 compounds
Occurrence & distributionGBIF42 216 records
Environmental DNA2 datasets · 4 countries12 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Pittosporum undulatum est une espèce de plantes à fleurs de la famille des Pittosporacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology27
Fruit length11 mm
⚠ sources differ — AusTraits: 11 mm · GIFT: 13 mm
Fruit length max14 mm
Fruit length min10 mm
Fruit width10 mm
Fruit width max12 mm
Fruit width min10 mm
Leaf length120 mm
Leaf length max150 mm
Leaf length min50 mm
Leaf mass288 mg
Leaf mass per area86.39 g/m2
Leaf size2 350 mm²
Leaf width40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 30 mm
Leaf width max40 mm
Leaf width min15 mm
Petiole length1.55 cm
Plant height5 m
⚠ sources differ — GIFT: 5 m · AusTraits: 14 m · TRY: 4.5 m
Plant height max30 m
Plant height min3 m
Seed length3 mm
Seed mass8.91 mg
⚠ sources differ — TRY: 8.91 mg · AusTraits: 6.21 mg · GIFT: 8.35 mg
Seed mass max13.17 mg
Seed mass min4.39 mg
Seed volume8.1 mm³
Seed volume max8.1 mm³
Seed volume min8.1 mm³
Seed width1.5 mm
Life cycle & reproduction20
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
Flower colourwhite
Flower length max12 mm
Flower length min10 mm
Flowering endMar
Flowering startFeb
Flowering timennnnnnnyyynn
Life formtree
Life spanperennial
Lifespan years40 years
⚠ sources differ — TRY: 40 years · AusTraits: 35 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Reproductive maturity6 years
Resprouting capacityresprouts
Self fertilizationabsent
Sex typedioecious
⚠ sources differ — AusTraits: dioecious · GIFT: bisexual
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 100 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
⚠ sources differ — AusTraits: dry · GIFT: fleshy
Fruit typecapsule
Growth formtree
Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf formlanceolate
Leaf shapeelliptical obovate obtriangular
Woodinesswoody
Physiology & chemistry7
Leaf dry-matter content (LDMC)425 mg/g
Leaf n13.1 mg/g
Leaf p0.869 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)9.11 mm²/mg
Wood density672 mg/cm³
Other traits2
Leaf arrangementalternate
Seeds per fruit>1000
03Chemical composition51 compounds
Compounds documented for Pittosporum undulatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Carbocyclic fatty acids6
Stigmastane steroids5
Oleanane triterpenoids4
Fatty aldehydes3
Lactones3
Documented compounds51 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-alpha-Pinene | present | LOTUS | |
| (1R,2S,5S,6R,9S,10S,13S,15R,16S)-6-ethyl-15,16-dihydroxy-5-methyl-17-oxapentacyclo[14.2.1.01,13.02,10.05,9]nonadecan-7-one | present | NPASS | |
| (1R,4S,4aR)-1,6-dimethyl-4-propan-2-yl-1,2,3,4,4a,7-hexahydronaphthalene | present | LOTUS | |
| (2S,3R,5S,8R,9S,10S,13S,14S,17R)-17-ethyl-2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,6,7,8,9,11,12,14,15,17-tetradecahydrocyclopenta[a]phenanthren-16-one | present | NPASS | |
| (2S,3S,4R,5S,8R,9S,10R,13S,14S,17R)-17-ethyl-2,3,4-trihydroxy-10,13-dimethyl-1,2,3,4,5,6,7,8,9,11,12,14,15,17-tetradecahydrocyclopenta[a]phenanthren-16-one | present | NPASS | |
| (R)-Limonene | present | LOTUS | |
| (Z)-9-Hexadecenal | present | LOTUS | |
| (Z)-Tridec-2-en-1-ol | present | LOTUS | |
| 1,15-Hexadecadiene | present | LOTUS | |
| 10-Phenyldecanoic acid | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum undulatum has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes6
GenBank sequences10
eDNA detections12
Countries4
The DNA barcodea real sequence read deposited for this species
AGAGCAACCAGCGAACTCGTAATACACATCCGGTCGGCGGTGATGGAGGCAACAGCTTCCCCATCCGCCGGCCCACGGACGGGGAGTGCC …
Pittosporum undulatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★rbcLa★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Pittosporum undulatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 242×CCDB · book-ipcn65 · CCDB · book-fedorov
CCDB · book-ipcn65 — Gros 1965
CCDB · book-fedorov — Gros 1965
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type42 216 records
Wild obs. + sensor39 594
Museum / vouchered1 989
Cultivated / captive58
Other575
Origin
Native201
Introduced2 076
Range
Area of Occupancy AOO42 444 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy97% within 1 km
≤100 m 26 739≤1 km 7 690≤10 km 664>10 km 282
35 375 georeferenced · 4 219 without coordinates
Open the mapobservation + sensor39 594
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 169≤1 km 260≤10 km 383>10 km 88
900 georeferenced · 1 089 without coordinates
Open the institutions mapphysical evidence1 989
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy78% within 1 km
≤100 m 1≤1 km 6≤10 km 2
9 georeferenced · 49 without coordinates
Open the mapnot free-living58
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 130 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Jardín Botanico de Bogotá José Celestino Mutis (JBB)location not on record | 477 |
| Mount Annan, AU | 208 |
| Canberra, AU | 202 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 160 |
| Museo Entomologico de Leonlocation not on record | 131 |
| Brisbane, AU | 91 |
| Adelaide, AU | 74 |
| Armidale, AU | 65 |
| Hobart, AU | 33 |
| Auckland, NZ | 30 |
| John T. Waterhouse Herbariumlocation not on record | 26 |
| Riverside, US | 22 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 20 |
| Kensington, AU | 19 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 18 |
| San Luis Obispo, US | 17 |
| Saint Louis, US | 16 |
| Batemans Bay, AU | 15 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| Canadian Department of Agriculturelocation not on record | 14 |
| San Diego, US | 13 |
| Wollongong, AU | 12 |
| Cape Town, ZA | 12 |
| Ivano-Frankivsk, UA | 12 |
| Lake Charles, US | 10 |
| Bronx, US | 9 |
| Claremont, US | 9 |
| Parkville, AU | 8 |
| Catalina Island Conservancylocation not on record | 8 |
| Pretoria, ZA | 8 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 7 |
| Wellington, NZ | 6 |
| Henry Brockhouse Collectionlocation not on record | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Santa Barbara, US | 5 |
| Altos de Pipe, VE | 5 |
| Christchurch, NZ | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| JBRJlocation not on record | 5 |
| GHPG$location not on record | 4 |
| Fredericksburg, US | 4 |
| CICYTEXlocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| UFABClocation not on record | 4 |
| Tampa, US | 4 |
| Long Beach, US | 4 |
| Beijing, CN | 4 |
| Smithfield, AU | 4 |
| Campo Mourão, BR | 4 |
| Northridge, US | 3 |
| CASlocation not on record | 3 |
| Davis, US | 3 |
| Moscow State Universitylocation not on record | 3 |
| US | 3 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 3 |
| Brasília, BR | 3 |
| Maringá, BR | 3 |
| PUC-RSlocation not on record | 2 |
| Cascavel, BR | 2 |
| UTFPR-SLlocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Mexico City, MX | 2 |
| Oskarshamn, SE | 2 |
| La Trobe Universitylocation not on record | 2 |
| arosemena tola, EC | 2 |
| Irvine, US | 2 |
| Fort Worth, US | 2 |
| Edinburgh, GB | 2 |
| Brisbane Botanic Gardens, Queensland Herbariumlocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Barcelona, ES | 2 |
| Jardín Botánico de Bogotá "José Celestino Mutis" (JBB)location not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Blumenau, BR | 2 |
| Santa Cruz, US | 2 |
| Bangkok, TH | 2 |
| Rotorua, NZ | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Badajoz, ES | 2 |
| UFPRlocation not on record | 2 |
| QCNElocation not on record | 2 |
| MAlocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| INMAlocation not on record | 1 |
| Fullerton, US | 1 |
| Pamplona, ES | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Valparaiso, CL | 1 |
| University of Johannesburglocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| San Jose, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Wlocation not on record | 1 |
| Görlitz, DE | 1 |
| Los Angeles, US | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| UChlocation not on record | 1 |
| La Paz, BO | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| LDlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| EL PASO, US | 1 |
| Bloomington, US | 1 |
| MeiseBGlocation not on record | 1 |
| Chapingo, MX | 1 |
| BISHlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Vitoria, ES | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Chengdu, CN | 1 |
| Sucre, BO | 1 |
| BGPAlocation not on record | 1 |
| Phoenix, US | 1 |
| Zürich, CH | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Londrina, BR | 1 |
| UNESP-RClocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| UnBlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| UFSClocation not on record | 1 |
| AUAlocation not on record | 1 |
| UFSMlocation not on record | 1 |
130 institutions · 1 965 of 1 989 vouchered records shown · 22 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Pittosporum undulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map4 countries0
Coastal Sage Scrub; Rocky Cobble
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 15.1–18.4
Seasonal swing summer↔winter7.40 °C
Max temp (day)19.4 °C 18.1–21.5
Min temp (night)12.2 °C 10.3–17.7
Precipitation70.4 mm/mo 11.9–110
Air humidity60.3 % 57.7–71.0
Moisture balance-28.0 mm/mo
Vapour deficit703 Pa 580–856
Wind speed2.90 m/s
Cloud cover35.2 % 21.2–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.