Pittosporum tenuifolium

Gaertn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records9 517

Data sources12

Biological traits51

DNA specimens0

eDNA detections0

Sources12 archives

Databases and archives Pittosporum tenuifolium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 517 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Chemical compositionLOTUS · NPASS3 compounds

Occurrence & distributionGBIF9 517 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT452 Mbp

01Narrative

Pittosporum tenuifolium is a small evergreen tree – up to 10 m – commonly known as ' and black matipo, and by other Māori names ' and '. Its small, very dark, reddish-purple flowers generally go unnoticed, and are scented only at night. The Latin means "slender-leaved"

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology22

Fruit length12 mm

⚠ sources differ — AusTraits: 12 mm · GIFT: 9.09 mm

Fruit length max11.4 mm

Fruit length min0.97 mm

Fruit width13.5 mm

⚠ sources differ — AusTraits: 13.5 mm · GIFT: 10 mm

Leaf length45 mm

Leaf length max30 mm

Leaf width30 mm

⚠ sources differ — AusTraits: 30 mm · GIFT: 15 mm

Leaf width max15 mm

Leaf width min15 mm

Petiole length0.95 cm

Plant height8 m

⚠ sources differ — AusTraits: 8 m · TRY: 6 m

Plant height max9 m

Seed length4.22 mm

⚠ sources differ — AusTraits: 4.22 mm · GIFT: 3.3 mm

Seed length max3.3 mm

Seed length min3.3 mm

Seed mass12 mg

⚠ sources differ — TRY: 12 mg · AusTraits: 10.68 mg · GIFT: 11.59 mg

Seed mass max21.41 mg

Seed mass min1.3 mg

Seed volume12 mm³

Seed volume max12 mm³

Seed volume min12 mm³

Seed width3.26 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: tree

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate ovate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio28.87 g/g

Leaf c497 mg/g

Leaf dry-matter content (LDMC)400 mg/g

Leaf n15.68 mg/g

Leaf p0.987 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.53 mm²/mg

Wood density622 mg/cm³

03Chemical composition3 compounds

Compounds documented for Pittosporum tenuifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Menthane monoterpenoids $ Monocyclic monoterpenoids1

Drimane sesquiterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-Limonene	present	LOTUS
Drim-8(12)-ene	present	NPASS
Terpinolene	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum tenuifolium has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMW191877.1 ↗157 922 bp

ACGT

CGAATTAGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCCCTAC …

Pittosporum tenuifolium chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Pittosporum tenuifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size452 325 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pittosporum tenuifolium0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2412×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · nw-europe-fl +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2496

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.

CCDB · ipcn-api-dl — Hanson, L., K. A. McMahon, M. A. T. Johnson & M. D. Bennett. 2001. First nuclear DNA C-values for another 25 angiosperm families. Ann. Bot. (Oxford) 88: 851–858.

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

CCDB · book-fedorov — Rattenbury 1957

CCDB · book-fedorov — Farnell (Gros 1965)

CCDB · kew — Hanson L., McMahon KA, Johnson MAT, Bennett MD. 2001. First nuclear DNA C-values for another 25 angiosperm families. Annals of Botany 88: 851-858

CCDB · Cave1958 — Rattenbury 1957

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 517 records

Wild obs. + sensor8 883

Museum / vouchered623

Cultivated / captive11

Origin

Native15

Introduced223

Range

Area of Occupancy AOO18 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 5 798≤1 km 637≤10 km 502>10 km 107

7 044 georeferenced · 1 839 without coordinates

Open the mapobservation + sensor8 883

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 31≤1 km 30≤10 km 34>10 km 5

100 georeferenced · 523 without coordinates

Open the institutions mapphysical evidence623

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 2>10 km 1

5 georeferenced · 6 without coordinates

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	196
Wellington, NZ	188
Christchurch, NZ	67
Rotorua, NZ	54
Museo Entomologico de Leonlocation not on record	18
Canberra, AU	16
Hobart, AU	15
Palmerston North, NZ	8
Adelaide, AU	5
Armidale, AU	5
Moscow State Universitylocation not on record	4
Saint Louis, US	3
Brisbane, AU	3
Canadian Department of Agriculturelocation not on record	3
Kew, GB	2
Mount Annan, AU	2
Adam Mickiewicz University in Poznańlocation not on record	2
Barcelona, ES	2
Wlocation not on record	2
Vitoria, ES	2
Honolulu, US	2
Cape Town, ZA	1
Riverside, US	1
Arcata, US	1
Santiago de Compostela, ES	1
North Carolina Zoological Parklocation not on record	1
Davis, US	1
La Paz, BO	1
Northridge, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Stockholm, SE	1
Bronx, US	1
Cochabamba, BO	1
John T. Waterhouse Herbariumlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Bangkok, TH	1
Chicago, US	1

37 institutions · 615 of 623 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pittosporum tenuifolium

At a glance

Sources12 archives

Size & morphology22

Life cycle & reproduction7

Diet & foraging1

Habitat & environment12

Physiology & chemistry9

Compound class profile2 classes

Documented compounds3 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type9 517 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions28 of 37 geolocated

Cultivated / Captivenot free-living

Record type9 517 records