Pittosporum revolutum

W.T.Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records10 950

Data sources6

Biological traits45

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Pittosporum revolutum's data was compiled from.

GBIFGlobal Biodiversity Information Facility10 950 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources45 traits

Occurrence & distributionGBIF10 950 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology19

Fruit length20 mm

Fruit width16 mm

Leaf length120 mm

Leaf length max150 mm

Leaf length min50 mm

Leaf mass per area68.25 g/m2

Leaf size2 904 mm²

⚠ sources differ — TRY: 2 904 mm² · AusTraits: 2 696 mm²

Leaf width55 mm

Leaf width max60 mm

Leaf width min15 mm

Petiole length0.8 cm

Plant height3 m

Plant height max4 m

Plant height min1 m

Seed length5 mm

Seed mass19.8 mg

⚠ sources differ — TRY: 19.8 mg · AusTraits: 17.11 mg · GIFT: 20.28 mg

Seed mass max20.28 mg

Seed mass min20.28 mg

Seed width2.87 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnnyynn

Life formshrub

Life span>30

⚠ sources differ — TRY: >30 · AusTraits: perennial · GIFT: perennial

Lifespan years30 years

Pollination syndromeinsect

Reproductive maturity3.5 years

Resprouting capacityresprouts

Sex typetrioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)16.11 mm²/mg

Wood density680 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum revolutum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY829038.1 ↗669 bp

ACGT

CTGCGGAAGGATCATTGTCGATACCTGCGCAGCAGAGCGACCAGCGAACTTGTAATACACATCCGATCGGCGGCGACGGAAGCGACAGCT …

Pittosporum revolutum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type10 950 records

Wild obs. + sensor9 737

Museum / vouchered881

Cultivated / captive7

Other325

Origin

Native223

Introduced2

Range

Area of Occupancy AOO19 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 7 677≤1 km 842≤10 km 242>10 km 213

8 974 georeferenced · 763 without coordinates

Open the mapobservation + sensor9 737

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 101≤1 km 145≤10 km 397>10 km 103

746 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence881

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2≤10 km 2

6 georeferenced · 1 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	223
Brisbane, AU	150
Canberra, AU	147
Museo Entomologico de Leonlocation not on record	142
Smithfield, AU	50
Armidale, AU	41
John T. Waterhouse Herbariumlocation not on record	28
Adelaide, AU	17
Wollongong, AU	17
Batemans Bay, AU	16
NSW Dept of Planning, Industry and Environmentlocation not on record	14
James Cook Townsvillelocation not on record	8
Kew, GB	8
Hobart, AU	6
Parkville, AU	3
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Tampa, US	1
IPA/SPlocation not on record	1
Wuzhou, CN	1
AUAlocation not on record	1
Monastir, TN	1
Uppsala, SE	1
Flagstaff, US	1

24 institutions · 880 of 881 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pittosporum revolutum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pittosporum revolutum

At a glance

Sources6 archives

Size & morphology19

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

At a glance

Record type10 950 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 950 records