Pittosporum ralphii

Kirk · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records1 115

Data sources7

Biological traits15

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Pittosporum ralphii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 115 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources15 traits

Occurrence & distributionGBIF1 115 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Pittosporum ralphii là một loài thực vật có hoa trong họ Pittosporaceae. Loài này được Kirk miêu tả khoa học đầu tiên năm 1871.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology7

Fruit length14 mm

Fruit width12 mm

Leaf length80 mm

Leaf width30 mm

Petiole length1.5 cm

Plant height4 m

⚠ sources differ — GIFT: 4 m · AusTraits: 3.75 m

Seed mass14.36 mg

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment5

Climatesubtropical

Fruit typecapsule

Growth formshrub

Leaf shapeelliptical oblanceolate oblong obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum ralphii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF635473.1 ↗776 bpNew Zealand

ACGT

GGCGGTTCGCTGCCCGCGACGTCGAAAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Pittosporum ralphii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pittosporum ralphii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 115 records

Wild obs. + sensor939

Museum / vouchered166

Cultivated / captive10

Origin

Introduced2

Range

Area of Occupancy AOO1 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 546≤1 km 104≤10 km 30>10 km 12

692 georeferenced · 247 without coordinates

Open the mapobservation + sensor939

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 17≤1 km 7≤10 km 1

25 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence166

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	68
Wellington, NZ	42
Christchurch, NZ	24
Rotorua, NZ	17
Hobart, AU	3
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	2
Mount Annan, AU	1
Chicago, US	1
Wlocation not on record	1
Armidale, AU	1
Vitoria, ES	1
València, ES	1
Durango, MX	1

14 institutions · 166 of 166 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pittosporum ralphii

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction2

Habitat & environment5

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 115 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 14 geolocated

Cultivated / Captivenot free-living

Record type1 115 records