Pittosporum oreillyanum

C.T.White · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records173

Data sources6

Biological traits32

DNA specimens4

eDNA detections2

Sources6 archives

Databases and archives Pittosporum oreillyanum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Pittosporum oreillyanum is a species of plant in the Pittosporaceae family. Found in the border regions between the states of New South Wales and Queensland in Australia. A shrub to small tree, up to 5 metres tall. This spiny plant may be seen growing in high altitude regions on the Mount Warning caldera. Often covered in hanging mosses and liverworts. First collected by botanical science by Cyril Tenison White in 1929. The type location is "Mount Hobwee, Lamington National Park, near the New South Wales–Queensland border, altitude 4000 feet." This plant first appeared in scientific literature in 1936 in the "Contributions to the Queensland Flora, No. 5. Proceedings of the Royal Society of Queensland".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology15

Fruit length9.5 mm

Fruit width9 mm

Leaf length6 mm

Leaf length max10 mm

Leaf length min2 mm

Leaf mass per area44.91 g/m2

Leaf size26.62 mm²

Leaf width4 mm

Leaf width max5 mm

Leaf width min2 mm

Petiole length0.15 cm

Plant height5 m

Seed length2 mm

Seed mass17.41 mg

Seed width1 mm

Life cycle & reproduction4

Dehiscencedehiscent

Flowering timennnnnnnnyyyn

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)22.79 mm²/mg

Wood density523 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum oreillyanum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY829037.1 ↗665 bp

ACGT

CTGCGGAAGGATCATTGTCGATACCTGCGCAGCAGAGCGACCAGCGAACTCGTAATACACATCCGGTCGGCGGTGACGGAGGCGACAGCT …

Pittosporum oreillyanum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type173 records

Wild obs. + sensor106

Museum / vouchered65

Cultivated / captive2

Origin

Native9

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 42≤1 km 5≤10 km 3>10 km 3

53 georeferenced · 53 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 18≤1 km 16≤10 km 20>10 km 3

57 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	22
Canberra, AU	16
Mount Annan, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	8
Museo Entomologico de Leonlocation not on record	4
Armidale, AU	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Smithfield, AU	1

8 institutions · 64 of 65 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pittosporum oreillyanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.6 °C

Min temp (night)12.0 °C

Precipitation130 mm/mo

Air humidity61.8 %

Moisture balance16.5 mm/mo

Vapour deficit718 Pa

Wind speed3.00 m/s

Cloud cover24.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)