Pittosporum multiflorum

(A.Cunn. ex London) L.W.Cayzer, Crisp & I.Telford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records7 137

Data sources7

Biological traits35

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Pittosporum multiflorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF7 137 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pittosporum multiflorum, known as the orange thorn, is a shrub growing in eastern Australia. The dense foliage provides a habitat for small birds and animals. It grows on shales or volcanic soils, from Eden, New South Wales north to Queensland, usually in or near rainforest areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length6.5 mm

Fruit width6.5 mm

Leaf length10 mm

Leaf length max12 mm

Leaf length min3 mm

Leaf mass per area50.93 g/m2

Leaf size55.92 mm²

Leaf width5.75 mm

Leaf width max8 mm

Leaf width min2.5 mm

Plant height3 m

⚠ sources differ — AusTraits: 3 m · TRY: 1.13 m

Plant height max3 m

Plant height min1 m

Seed length3 mm

Seed mass7.54 mg

⚠ sources differ — TRY: 7.54 mg · AusTraits: 8.2 mg

Seed width1 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyynnnnnnyyyy

Life formshrub or tree

Life spanperennial

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical obovate orbicular widely_ovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)19.73 mm²/mg

Wood density700 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum multiflorum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY829036.1 ↗650 bp

ACGT

TTGCCGATACCTGCGCAGCAGAGGGACCAGCGAACTCGTAATACACATCCGGTCGGCGGTGACGGAGGCGACAGCTTCCCCAGCCACCGG …

Pittosporum multiflorum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type7 137 records

Wild obs. + sensor6 576

Museum / vouchered482

Cultivated / captive9

Other70

Origin

Native151

Introduced3

Range

Area of Occupancy AOO13 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 5 658≤1 km 407≤10 km 158>10 km 48

6 271 georeferenced · 305 without coordinates

Open the mapobservation + sensor6 576

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 61≤1 km 78≤10 km 202>10 km 84

425 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence482

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy89% within 1 km

≤100 m 4≤1 km 4≤10 km 1

9 georeferenced

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	151
Brisbane, AU	89
Canberra, AU	83
Museo Entomologico de Leonlocation not on record	66
Armidale, AU	26
John T. Waterhouse Herbariumlocation not on record	16
NSW Dept of Planning, Industry and Environmentlocation not on record	11
Wollongong, AU	11
Adelaide, AU	8
Batemans Bay, AU	7
Smithfield, AU	5
Hobart, AU	3
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
IPA/SPlocation not on record	1
Cambridge University Herbariumlocation not on record	1

16 institutions · 481 of 482 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pittosporum multiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter11.6 °C

Max temp (day)21.3 °C

Min temp (night)11.0 °C

Precipitation91.4 mm/mo

Air humidity59.9 %

Moisture balance-14.6 mm/mo

Vapour deficit728 Pa

Wind speed1.80 m/s

Cloud cover23.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pittosporum multiflorum

At a glance

Sources7 archives

Size & morphology16

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Record type7 137 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 137 records