Pittosporum moluccanum

(Lam.) Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records357

Data sources7

Biological traits30

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Pittosporum moluccanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility357 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF357 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

蘭嶼海桐（学名：）为海桐科海桐屬下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length17 mm

Fruit width17 mm

Leaf length122 mm

Leaf width42.5 mm

Petiole length2.2 cm

Plant height6 m

Plant height max6 m

Plant height min2 m

Seed length3.5 mm

Seed mass19.89 mg

⚠ sources differ — TRY: 19.89 mg · AusTraits: 18.14 mg · GIFT: 19.89 mg

Seed mass max19.89 mg

Seed mass min19.89 mg

Seed width3.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timenyynnnnnnnnn

Life formtree

Life spanperennial

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Fruit fleshinessfleshy

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: woody

Leaf compoundnesssimple

Leaf shapeelliptical obovate ovate

Woodinesswoody

Physiology & chemistry1

Wood density570 mg/cm³

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum moluccanum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY829035.1 ↗670 bp

ACGT

CTGCGGAAGGATCATTGTCGATACTTGCGTAGCGAACCAACCAGCGAACTCGTAATACACATTCGGTCGGCGGTGACGGAAGTGACAGCT …

Pittosporum moluccanum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type357 records

Wild obs. + sensor79

Museum / vouchered278

Origin

Native12

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 32≤1 km 6≤10 km 8>10 km 3

49 georeferenced · 30 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 11≤1 km 6≤10 km 52>10 km 2

71 georeferenced · 207 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	35
Palmerston, AU	23
National Museum of Natural Sciencelocation not on record	20
Kensington, AU	18
Canberra, AU	13
Taipei, TW	10
Kew, GB	8
Miami, US	6
Smithfield, AU	6
Beijing, CN	5
TAIElocation not on record	5
Brisbane, AU	4
University of Stellenboschlocation not on record	4
Taipei, TW	4
Mount Annan, AU	3
BGPAlocation not on record	3
Davis, US	2
Museo Entomologico de Leonlocation not on record	2
Saint Louis, US	2
Fort Worth, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Adelaide, AU	1

22 institutions · 177 of 278 vouchered records shown · 101 without an institution code

09Environmental DNA1 detections

Where the DNA of Pittosporum moluccanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)