Pittosporum heterophyllum

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records579

Data sources7

Biological traits11

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Pittosporum heterophyllum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF579 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Pittosporum heterophyllum, le Pittosporum hétérophylle, est une espèce de plantes à fleurs de la famille des Pittosporacées originaire de Chine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height4 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 000 m

Elevation mean2 450 m

Elevation min1 800 m

Growth formshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum heterophyllum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPX744296.1 ↗1 428 bpChina · 2012

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATCAA …

UNVERIFIED: Pittosporum heterophyllum voucher CPG14429 rbcL gene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pittosporum heterophyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-ipcn65 · CCDB · book-fedorov

CCDB · book-ipcn65 — Gros 1965

CCDB · book-fedorov — Gros 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type579 records

Wild obs. + sensor50

Museum / vouchered527

Cultivated / captive1

Other1

Origin

Native2

Introduced42

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 44

48 georeferenced · 2 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 522 without coordinates

Open the institutions mapphysical evidence527

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	185
Kunming, CN	84
Chengdu, CN	57
Beijing, CN	48
Nanjing, CN	36
Guangzhou, CN	34
Seoul, KR	22
Chengdu, CN	11
Siouxland Heritage Museumlocation not on record	8
Guilin, CN	5
CASlocation not on record	3
Guangzhou, CN	2
Southwest Forestry Collegelocation not on record	2
Riverside, US	2
MAlocation not on record	2
Saint Louis, US	2
València, ES	2
Vitoria, ES	2
Kew, GB	1
Vancouver, CA	1
Chicago, US	1
Barcelona, ES	1
Fort Worth, US	1
Bangkok, TH	1
CICYTEXlocation not on record	1
Clemson, US	1
Chongqing Natural History Museumlocation not on record	1
University of Stellenboschlocation not on record	1
Miami, US	1
Guiyang, CN	1

30 institutions · 519 of 527 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.