Pittosporum ferrugineum

W.T.Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records948

Data sources7

Biological traits40

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Pittosporum ferrugineum's data was compiled from.

GBIFGlobal Biodiversity Information Facility948 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF948 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length9.7 mm

Fruit width8.85 mm

Leaf length97.5 mm

Leaf size3 222 mm²

⚠ sources differ — TRY: 3 222 mm² · AusTraits: 6 300 mm²

Leaf width25 mm

Petiole length1.75 cm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 15 m · TRY: 3.6 m

Plant height max15 m

Seed length5 mm

Seed mass11.14 mg

⚠ sources differ — TRY: 11.14 mg · AusTraits: 11.58 mg · GIFT: 10.91 mg

Seed mass max11.56 mg

Seed mass min9.9 mg

Seed width2.95 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyyynnnnnn

Life formtree

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_elliptical

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio30.71 g/g

Leaf c527 mg/g

Leaf n17.2 mg/g

Leaf p3.91 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.97 mm²/mg

Wood density517 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum ferrugineum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY829032.1 ↗667 bp

ACGT

CTGCGGAAGGATCATTGTCGATACCTGCGCAGCAGAGCGACCAGCGAACTCGTAATACACATCCGATCGGCGGCGACGGAAGCGACAGCT …

Pittosporum ferrugineum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type948 records

Wild obs. + sensor30

Museum / vouchered707

Cultivated / captive3

Other208

Origin

Native7

Range

Area of Occupancy AOO2 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 12≤1 km 8≤10 km 1>10 km 2

23 georeferenced · 7 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 32≤1 km 41≤10 km 91>10 km 25

189 georeferenced · 518 without coordinates

Open the institutions mapphysical evidence707

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	127
Brisbane, AU	68
Kew, GB	44
Honolulu, US	27
Canberra, AU	18
Bronx, US	15
Palmerston, AU	13
South Kensington, GB	10
University of Stellenboschlocation not on record	10
Adelaide, AU	8
Saint Louis, US	7
Mount Annan, AU	5
Llocation not on record	4
CASlocation not on record	4
Xiamen, CN	3
San Diego, US	3
Cibinong, ID	3
Ann Arbor, US	2
James Cook Townsvillelocation not on record	2
Kensington, AU	2
Auckland, NZ	2
Nanjing, CN	1
BISHlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Monastir, TN	1
Museo Entomologico de Leonlocation not on record	1
Guangzhou, CN	1
Cambridge, US	1
Fort Worth, US	1
Edinburgh, GB	1

30 institutions · 386 of 707 vouchered records shown · 321 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pittosporum ferrugineum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 23.7–23.7

Seasonal swing summer↔winter8.90 °C

Max temp (day)25.8 °C

Min temp (night)21.5 °C

Precipitation196 mm/mo

Air humidity60.3 %

Moisture balance16.1 mm/mo

Vapour deficit1,155 Pa

Wind speed5.80 m/s

Cloud cover29.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)