Pittosporum crassifolium

Banks & Sol. ex A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Pittosporum

At a glance

Occurrence records5 087

Data sources9

Biological traits35

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Pittosporum crassifolium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 087 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources35 traits

Occurrence & distributionGBIF5 087 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Pittosporum crassifolium là một loài thực vật có hoa trong họ Pittosporaceae. Loài này được Banks & Sol. ex A.Cunn. miêu tả khoa học đầu tiên năm 1839.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology18

Fruit length20 mm

Fruit width20 mm

Leaf length55 mm

Leaf length max70 mm

Leaf length min40 mm

Leaf size3 162 mm²

Leaf width17.5 mm

Leaf width max20 mm

Leaf width min13 mm

Petiole length1 cm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 9 m · LEDA: 10 m · TRY: 10 m

Plant height max9 m

Plant height min1 m

Seed length4.79 mm

Seed mass26.33 mg

⚠ sources differ — TRY: 26.33 mg · AusTraits: 20.08 mg · GIFT: 26.21 mg

Seed mass max37.17 mg

Seed mass min16.6 mg

Seed width3.9 mm

Life cycle & reproduction4

Deciduousnessevergreen

Dehiscencedehiscent

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 700 m

Elevation min914 m

Epiphyteterrestrial

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: Tree, Shrub

Leaf compoundnesssimple

Leaf shapeoblanceolate obovate obtriangular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pittosporum crassifolium has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY829030.1 ↗258 bp

ACGT

GCCCCCCAACCCTCCCCATCCCATCAGGGGTGCTGAGGGCGGGGGAGCGGATACTGGCCTCCCGTGCCTCGATGTGCGGTTGGCCCAAAT …

Pittosporum crassifolium internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pittosporum crassifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×CCDB · new-zealand · CCDB · nw-europe-fl · CCDB · book-ipcn65 +2

CCDB · new-zealand

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2495

CCDB · book-ipcn65 — Gros 1965

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.

CCDB · book-fedorov — Gros 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 087 records

Wild obs. + sensor4 600

Museum / vouchered385

Cultivated / captive102

Origin

Native3

Introduced147

Range

Area of Occupancy AOO6 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 2 655≤1 km 353≤10 km 708>10 km 73

3 789 georeferenced · 811 without coordinates

Open the mapobservation + sensor4 600

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 19≤1 km 42≤10 km 23>10 km 8

92 georeferenced · 293 without coordinates

Open the institutions mapphysical evidence385

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 100 without coordinates

Open the mapnot free-living102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	168
Wellington, NZ	59
Christchurch, NZ	28
Rotorua, NZ	19
Canberra, AU	12
Hobart, AU	11
Palmerston North, NZ	9
Museo Entomologico de Leonlocation not on record	8
Mount Annan, AU	7
Canadian Department of Agriculturelocation not on record	7
Claremont, US	5
Adelaide, AU	5
Pretoria, ZA	4
Riverside, US	4
Long Beach, US	4
San Diego, US	3
GHPG$location not on record	2
John T. Waterhouse Herbariumlocation not on record	2
CASlocation not on record	2
South Kensington, GB	2
Adam Mickiewicz University in Poznańlocation not on record	2
MeiseBGlocation not on record	2
EL PASO, US	1
Armidale, AU	1
San Jose, US	1
Northridge, US	1
Chicago, US	1
Smithfield, AU	1
Edinburgh, GB	1
Kew, GB	1
Brisbane, AU	1
Victoria, CA	1
Honolulu, US	1

33 institutions · 376 of 385 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pittosporum crassifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 12.4–12.4

Seasonal swing summer↔winter9.70 °C

Max temp (day)15.8 °C

Min temp (night)9.10 °C

Precipitation363 mm/mo

Air humidity66.2 %

Moisture balance241 mm/mo

Vapour deficit485 Pa

Wind speed7.00 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pittosporum crassifolium

At a glance

Sources9 archives

Size & morphology18

Life cycle & reproduction4

Diet & foraging1

Habitat & environment11

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 087 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 087 records