Pithecophaga jefferyi

Ogilvie-Grant, 1896 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Accipitriformes/Accipitridae/Pithecophaga

At a glance

Occurrence records654

Data sources12

Biological traits34

DNA specimens31

eDNA detections31

Sources12 archives

Databases and archives Pithecophaga jefferyi's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility654 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF654 records

Environmental DNA1 datasets · 1 countries31 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The Philippine eagle (Pithecophaga jefferyi), also known as the monkey-eating eagle or great Philippine eagle, is a critically endangered species of eagle of the family Accipitridae which is endemic to forests in the Philippines. It has brown and white-colored plumage, a shaggy crest, and generally measures 86 to in length and weighs 4.04 to. The Philippine eagle is considered the largest of the extant eagles in the world in terms of length and wing surface area, with only Steller's sea eagle and the Harpy eagle being larger in terms of weight and bulk. It has been declared the national bird of the Philippines.Kennedy, R. S., Gonzales, P. C.; Dickinson, E. C.; Miranda, H. C. Jr. and Fisher, T. H. (2000). A Guide to the Birds of the Philippines. Oxford University Press, New York. The most significant threat to the species is loss of habitat, a result of high levels of deforestation throughout most of its range. Killing a Philippine eagle is a criminal offence, punishable by law with up to 12 years imprisonment and heavy fines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology14

Beak depth49.6 mm

Beak length (culmen)85.3 mm

Beak length (nares)57 mm

Beak width20.8 mm

Body mass6 500 g

⚠ sources differ — AnAge: 6 500 g · AmnioteDB: 5 325 g · AVONET: 5 175 g · EltonTraits: 5 175 g

Body mass (female)6 000 g

Body mass (male)4 557 g

Hand-wing index30.3

Kipp's distance179 mm

SVL95 cm

Secondary length407 mm

Tail length423 mm

Tarsus length134 mm

Wing length586 mm

Life cycle & reproduction8

Age at maturity (male)2 555 days

Age at sexual maturity1 825 days

Fledging age105 days

Gestation63 days

Incubation61.5 days

Litter size1

Litters per year0.5 /year

Max. longevity492 months

Diet & foraging8

Canopy30 %

Ground30 %

Midhigh20 %

Trophic levelcarnivore

Trophic nicheVertivore

Understory20 %

Vertebrate ectotherm20 %

Vertebrate endotherm80 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size142 257 km²

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pithecophaga jefferyi has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections31

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P685 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

531Tvariable

ATCTTCGGGGCCTGAGCTGGCATAGTCGGCACTGCCCTCAGCCTACTCATCCGCGCAGAACTCGGCCAGCCCGGCACCCTCCTAGGAGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.29%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Haliaeetus albicillasame family10.2%Gyps coprotheressame family10.4%Haliaeetus pelagicussame family10.4%Accipiter bicolorsame family10.4%Circaetus gallicussame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pithecophaga jefferyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 248 363 504 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pithecophaga jefferyi1.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Chromosome records66–662n range66median66mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 662×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type654 records

Wild obs. + sensor622

Museum / vouchered32

Origin

Native47

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 18≤1 km 3>10 km 31

52 georeferenced · 570 without coordinates

Open the mapobservation + sensor622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 1≤10 km 5>10 km 4

10 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	4
Cambridge, US	3
Berkeley, US	2
New Haven, US	1

4 institutions · 10 of 32 vouchered records shown · 22 without an institution code

09Environmental DNA31 detections

Where the DNA of Pithecophaga jefferyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 24.9–26.4

Seasonal swing summer↔winter1.50 °C

Max temp (day)29.2 °C 25.5–29.2

Min temp (night)23.1 °C 23.1–24.2

Precipitation111 mm/mo 111–268

Air humidity63.9 % 62.8–63.9

Moisture balance-31.1 mm/mo

Vapour deficit1,237 Pa 1,168–1,237

Wind speed2.70 m/s

Cloud cover33.9 % 33.9–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)