Pithanus maerkelii

(Herrich-Schaeffer, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Pithanus

At a glance

Occurrence records3 813

Data sources7

Biological traits2

DNA specimens47

eDNA detections60

Sources7 archives

Databases and archives Pithanus maerkelii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 813 records

Environmental DNA3 datasets · 9 countries60 detections

DNA & barcodingBOLD47 specimens

01Narrative

Pithanus maerkelii is a species of plant bug in the family Miridae. It is found in Europe, but occurs in the Mediterranean basin only on the western northern edge. To the east spreads across the Palearctic to European Russia and Ukraine. It is an adventive species in North America. Pithanus maerkelii is found on Poaceae, Cyperaceae and Juncaceae- Agrostis , Festuca, Nardus, Deschampsia, Carex, Scirpus, Juncus. They suck on the stalks (knots) and also on the ears (ovules).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)predator

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pithanus maerkelii has left across the world's sequence archives.

At a glance

DNA specimens47

BINs1

Marker genes1

eDNA detections60

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

26Amostly conserved

188Avariable

233Tmostly conserved

266Amostly conserved

288Gmostly conserved

359Cmostly conserved

371Amostly conserved

386Gmostly conserved

401Amostly conserved

498Cvariable

CTTTATATTTCATATTCGGAATATGAGCCGGAATATTAGGGACATCCCTAAGATGAATTATTCGTATTGAATTAGGAATACCCGGGTCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes8

BIN1

Most divergent pair1.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pithanus marshallisame genus2.6%Taylorilygus apicalissame family12.2%Megacoelum infusumsame family12.5%Tropidosteptes vittifronssame family12.7%Tropidosteptes pacificussame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 813 records

Wild obs. + sensor3 374

Museum / vouchered345

Cultivated / captive21

Fossil1

Other72

Origin

Native4

Range

Area of Occupancy AOO9 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 440≤1 km 636≤10 km 999>10 km 58

3 133 georeferenced · 241 without coordinates

Open the mapobservation + sensor3 374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 70≤1 km 96≤10 km 95>10 km 1

262 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence345

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Aarhus Denmarklocation not on record	71
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	24
SLU Artdatabankenlocation not on record	23
CBDClocation not on record	22
NHMOlocation not on record	22
Uniwersytet Śląski w Katowicachlocation not on record	15
Tartu, EE	14
NCMGlocation not on record	13
San Francisco, US	13
ZMAAlocation not on record	10
Bonn, DE	9
South Kensington, GB	7
Tromsø, NO	7
Philadelphia, US	5
UAclocation not on record	5
DFlocation not on record	4
BioFokuslocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	4
Natural History Museum, Londonlocation not on record	4
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
Ugentlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
ZSMlocation not on record	2
UO-CeStuBiolocation not on record	2
neflocation not on record	2
Jyväskylä, FI	2
WGSlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Metsähallituslocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Helsinki, FI	1
Trondheim, NO	1
DFFW2018location not on record	1

35 institutions · 300 of 345 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA60 detections

Where the DNA of Pithanus maerkelii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys3

Countries9

Verifiable raw sequence linked26

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map9 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…WetlandMixed HabitatUrban areaForestFallow field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.0–17.3

Seasonal swing summer↔winter18.0 °C

Max temp (day)18.2 °C 16.2–19.2

Min temp (night)10.9 °C 8.80–15.1

Precipitation77.6 mm/mo 42.2–129

Air humidity61.0 % 59.0–64.3

Moisture balance-35.7 mm/mo -87.4–11.3

Vapour deficit643 Pa 579–751

Wind speed3.10 m/s 2.30–5.00

Cloud cover43.9 % 39.8–57.5

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pithanus maerkelii

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 813 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 813 records