Pitaviaster haplophyllus

(F.Muell.) T.G.Hartley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Pitaviaster

At a glance

Occurrence records424

Data sources9

Biological traits25

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Pitaviaster haplophyllus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Chemical compositionLOTUS · NPASS72 compounds

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Jambolifera tetrandra là một loài thực vật có hoa trong họ Cửu lý hương. Loài này được Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length17.5 mm

Fruit width10.5 mm

Leaf length155 mm

Leaf width60 mm

Petiole length2 cm

Plant height13 m

Seed length9 mm

Seed width8 mm

Life cycle & reproduction4

Flowering timeyyyyyynnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: Tree

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_obovate obovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density719 mg/cm³

03Chemical composition72 compounds

Compounds documented for Pitaviaster haplophyllus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lanostane, Tirucallane and Euphane triterpenoids8

Pimarane and Isopimarane diterpenoids5

Serratane triterpenoids5

Abietane diterpenoids5

Acridone alkaloids4

Documented compounds72 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(-)-beta-Phellandrene	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Borneol	present	NPASS
(1R,4aS,4bR,7R,9R,10aR)-7-ethenyl-1-(hydroxymethyl)-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthren-9-ol	present	NPASS
(1R,4aS,4bR,8aS,10aS)-8a-ethenyl-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bS,10aR)-1,4a-dimethyl-7-propan-2-yl-2,3,4,4b,5,6,10,10a-octahydrophenanthrene-1-carboxylic acid	present	NPASS
(1S,6R,11R,12S,15S,16R,19S,21R)-19-methoxy-1,7,7,11,16,20,20-heptamethylpentacyclo[13.8.0.03,12.06,11.016,21]tricos-3-en-8-one	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pitaviaster haplophyllus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ225784.1 ↗422 bp

ACGT

GGATCGCGGCGACGCGGGCGGTTCGCTGCCTGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAA …

Pitaviaster haplophyllus isolate 281 internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type424 records

Wild obs. + sensor17

Museum / vouchered381

Cultivated / captive3

Other23

Origin

Native25

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 5≤1 km 2>10 km 3

10 georeferenced · 7 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 66≤1 km 28≤10 km 136>10 km 40

270 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence381

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	128
Brisbane, AU	113
Canberra, AU	41
Museo Entomologico de Leonlocation not on record	39
Mount Annan, AU	23
Kew, GB	7
Palmerston, AU	5
Parkville, AU	4
James Cook Townsvillelocation not on record	3
Armidale, AU	2
Honolulu, US	2
Australian Tropical Herbariumlocation not on record	2
CJBGlocation not on record	1
Adelaide, AU	1

14 institutions · 371 of 381 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Pitaviaster haplophyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.1–23.1

Seasonal swing summer↔winter7.30 °C

Max temp (day)27.6 °C 26.0–28.3

Min temp (night)19.2 °C 15.8–19.6

Precipitation164 mm/mo 45.2–233

Air humidity65.4 % 47.8–69.9

Moisture balance-4.10 mm/mo -115–63.3

Vapour deficit987 Pa 840–1,497

Wind speed2.70 m/s 2.00–3.70

Cloud cover46.0 % 23.7–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)