Pistacia vera

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Pistacia

At a glance

Occurrence records2 039

Data sources18

Biological traits32

DNA specimens5

eDNA detections5

Sources18 archives

Databases and archives Pistacia vera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 039 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

foodatlascompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

phenolexplorercompounds

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS · PhenolExplorer5 884 compounds

Occurrence & distributionGBIF2 039 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · NCBI≈671 Mbp

01Narrative

Le pistachier, pistachier commun, pistachier cultivé ou pistachier vrai, est un arbuste de 3 à 10 mètres, de la famille des Anacardiaceae. Cet arbuste originaire des zones arides du Moyen-Orient, fut d'abord cultivé il y a 3 000 à 4 000 ans en Iran. Il fut introduit par la suite dans le bassin méditerranéen par les Romains au début de l'ère chrétienne. Le pistachier est cultivé pour ses amandes comestibles. Celles-ci nommées « pistaches », sont utilisées dans l'alimentation humaine et en particulier grillés à l'apéritif ou en pâtisserie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology12

Fruit length20 mm

Fruit length max20 mm

Fruit length min20 mm

Fruit width10 mm

Fruit width max10 mm

Fruit width min10 mm

Plant height7 m

Plant height max10 m

Plant height min5 m

Seed mass427 mg

⚠ sources differ — TRY: 427 mg · LEDA: 1 176 mg · GIFT: 1 176 mg

Seed mass max1 176 mg

Seed mass min1 176 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Flowering endMay

Flowering startMar

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min450 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest, hills, meadows, mountains, shrubberies, stony places

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry3

Leaf n19.65 mg/g

Leaf p1.09 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition5 884 compounds

Compounds documented for Pistacia vera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingNuts

Compound class profile5 classes

Aminoacids162

Glycerophospholipids57

Unsaturated fatty acids47

Pyridine alkaloids35

Cinnamic acids and derivatives30

Documented compounds5 884 total

Tissue Source Quantified only

Compound	Amount	Source
lipid	45,020 mg/100g	FoodAtlas
Elaidic acid	35,476 mg/100g	FooDB
L-ASPARAGINE	15,200 mg/100g	FoodAtlas
ASPARAGINE	15,200 mg/100g	FoodAtlas
(Z,Z)-9,12-Octadecadienoic acid	13,600 mg/100g	FooDB

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pistacia vera has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX387157.1 ↗226 bpChina · 2024

ACGT

CGCATCGTTGCCCCCCGCCCAAGATCCTGCGATCTTGCGGCGGTGGGCGGAAAATGGCCTCCCGTGTGCCTGCGCCCGCGGTTGGCCCAA …

Pistacia vera internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Pistacia vera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈671 119 336 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pistacia vera0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 304×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +1

CCDB · ipcn-api-dl — BOCHANTSEVA, Z. P. 1972. O chislakh chromosom. Pp. 45-53 in Introd. Akkli. Rasteny Akad. Nauk Uzbekist. SSR.

CCDB · book-indian_vol1 — Zohary, M. 1952

CCDB · book-fedorov — Zohary M. 1952

CCDB · book-atlas-flowering-plants — Haran, Zohary 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.5% BUSCO

08Occurrence & distribution

Record type2 039 records

Wild obs. + sensor1 503

Museum / vouchered239

Cultivated / captive50

Other247

Origin

Native43

Introduced1

Range

Area of Occupancy AOO4 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 944≤1 km 65≤10 km 72>10 km 11

1 092 georeferenced · 411 without coordinates

Open the mapobservation + sensor1 503

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 6≤1 km 16≤10 km 14>10 km 3

39 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence239

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the mapnot free-living50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	40
Moscow State Universitylocation not on record	20
Riverside, US	12
GMBAlocation not on record	12
Santa Barbara, US	8
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	8
Saint Louis, US	8
Academy of Sciences of the Republic of Uzbekistanlocation not on record	7
Canadian Department of Agriculturelocation not on record	7
Lanzhou, CN	7
AZE009location not on record	7
Yangling, CN	6
Xian, CN	6
Beijing, CN	5
San Diego, US	4
Berlin, DE	4
Davis, US	3
CASlocation not on record	3
Bronx, US	3
Museo della Bonifica di San Donà di Piavelocation not on record	3
CICYTEXlocation not on record	3
Claremont, US	3
EL PASO, US	3
LDlocation not on record	2
University of Stellenboschlocation not on record	2
Kunming, CN	2
Kew, GB	2
BIO-UNIPIlocation not on record	2
Durango, MX	2
HAWlocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Badajoz, ES	2
MHNAIXlocation not on record	1
Bratislava, SK	1
WTUlocation not on record	1
Boise, US	1
Wlocation not on record	1
Pocatello, US	1
Urumqi, CN	1
Karlsruhe, DE	1
Dresden, DE	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
College of the Atlantic, Museumlocation not on record	1
AZE015location not on record	1
GJOlocation not on record	1
Vitoria, ES	1
PRClocation not on record	1
Angwin, US	1
Mexico City, MX	1
Wuzhou, CN	1

50 institutions · 218 of 239 vouchered records shown · 21 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Pistacia vera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pistacia vera

At a glance

Sources18 archives

Size & morphology12

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

Compound class profile5 classes

Documented compounds5 884 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 039 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions28 of 50 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Documented compounds5 884 total

Record type2 039 records