Pistacia saportae

Burnat · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Pistacia

At a glance

Occurrence records1 149

Data sources5

Biological traits0

DNA specimens0

eDNA detections7

Sources5 archives

Databases and archives Pistacia saportae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 149 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingNCBIsequences

01Narrative

Pistacia saportae is a species of tree in the family Anacardiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pistacia saportae has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF193103.1 ↗673 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCAAGCAGAACGACCCGTGAACCTGTCATAACATCGGGGGCCTATGGGCT …

Pistacia x saportae voucher T10 clone 4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS8

plant barcodefungal barcode

08Occurrence & distribution

Record type1 149 records

Wild obs. + sensor1 059

Museum / vouchered90

Origin

Native76

Range

Area of Occupancy AOO2 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 229≤1 km 101≤10 km 596>10 km 23

949 georeferenced · 110 without coordinates

Open the mapobservation + sensor1 059

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 6≤1 km 29≤10 km 21>10 km 1

57 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
València, ES	17
Museo della Bonifica di San Donà di Piavelocation not on record	13
BClocation not on record	10
CICYTEXlocation not on record	7
Barcelona, ES	6
Alicante, ES	4
Vitoria, ES	3
MAlocation not on record	2
Madrid, ES	2
Entomological Society of Latvialocation not on record	2
College of the Atlantic, Museumlocation not on record	2
Sevilla, ES	2
Madrid, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Phyletisches Museum Jenalocation not on record	1
BIO-UNIPIlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Hunan Geological Museumlocation not on record	1

18 institutions · 76 of 90 vouchered records shown · 14 without an institution code

09Environmental DNA7 detections

Where the DNA of Pistacia saportae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pistacia saportae

At a glance

Sources5 archives

At a glance

Record type1 149 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 149 records