Pistacia atlantica

Desf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Pistacia

At a glance

Occurrence records3 243

Data sources13

Biological traits42

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Pistacia atlantica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources42 traits

Chemical compositionLOTUS · NPASS69 compounds

Occurrence & distributionGBIF3 243 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈505 Mbp

01Narrative

Pistacia atlantica, également connu sous le nom de Pistachier atlantique ou Pistachier de l'Atlas, est un arbre à feuillage caduc de la famille des Anacardiacées. Il existe trois sous-variétés de Pistacia Atlantica: cabulica, kurdica, mutica

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length max6 mm

Fruit length min6 mm

Fruit width max6 mm

Fruit width min5.5 mm

Inflorescence length max15 cm

Inflorescence length min10 cm

Plant height5.85 m

Plant height max15 m

Plant height min4 m

Seed mass120 mg

Seed mass max127 mg

Seed mass min115 mg

Seed volume75 mm³

Seed volume max75 mm³

Seed volume min75 mm³

Life cycle & reproduction9

Deciduousnessdeciduous

Flower colourgreen

Flowering endApr

Flowering startMar

Life formtree

Life spanperennial

Lifespan years8 years

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 500 m

Elevation min600 m

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTmountains, rivers, saline places

Leaf formimparipinnate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density740 mg/cm³

Other traits2

Inflorescencepanicle

Plant support typefree-standing

03Chemical composition69 compounds

Compounds documented for Pistacia atlantica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Stigmastane steroids6

Flavonols6

Lanostane, Tirucallane and Euphane triterpenoids5

Pinane monoterpenoids4

Acyclic monoterpenoids4

Documented compounds69 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	LOTUS
(+)-alpha-Pinene	present	LOTUS
(-)-beta-Pinene	present	LOTUS
(-)-Caryophyllene	present	NPASS
(-)-trans-Carveol	present	LOTUS
(1R,2S,8R,12S)-12-ethenyl-2-hydroxy-5,12-dimethyl-9-methylidene-3,11-dioxatricyclo[6.3.1.02,6]dodec-5-ene-4,10-dione	present	NPASS
(1R-(1alpha,2beta,4beta,6alpha))-2,2,7-trimethyl-3-oxatricyclo(4.1.1.02,4)octane	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-15-[(2R)-6,6-dimethyl-5-methylideneheptan-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pistacia atlantica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON026858.1 ↗257 bp

ACGT

GTGCNGCGTGCCTCCCCCGCGTGCTTCGTCGGGTGTCGGTCGTACGCTTCTGCGTGCGACTGCCCCGTCGTTGCGCATTAACGAACCCCG …

Pistacia atlantica clone patlantica_B4 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Pistacia atlantica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈505 281 571 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pistacia atlantica0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-fedorov

CCDB · book-fedorov — Zohary M. 1952

n 151×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 243 records

Wild obs. + sensor2 873

Museum / vouchered301

Cultivated / captive3

Other66

Origin

Native59

Introduced1

Range

Area of Occupancy AOO4 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 363≤1 km 129≤10 km 243>10 km 25

760 georeferenced · 2 113 without coordinates

Open the mapobservation + sensor2 873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 17≤1 km 52≤10 km 29>10 km 4

102 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence301

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	66
Riverside, US	23
LDlocation not on record	17
BClocation not on record	16
Canadian Department of Agriculturelocation not on record	16
Wlocation not on record	10
Santa Barbara, US	9
Kew, GB	9
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	8
Bronx, US	7
Claremont, US	7
MAlocation not on record	6
Paris, FR	6
Rishon Le Zion, IL	6
Museo della Bonifica di San Donà di Piavelocation not on record	6
Saint Louis, US	5
GZUlocation not on record	5
CICYTEXlocation not on record	4
Davis, US	4
San Luis Obispo, US	4
Salamanca, ES	3
San Diego, US	3
València, ES	3
University of Stellenboschlocation not on record	3
Berlin, DE	3
Durham, US	2
Phoenix, US	2
US	2
PRClocation not on record	2
Museo Achille Folettolocation not on record	2
Zürich, CH	2
Alicante, ES	2
San Sebastián, ES	1
Orem, US	1
Edinburgh, GB	1
Helsinki, FI	1
BDBClocation not on record	1
Entomological Society of Latvialocation not on record	1
Vitoria, ES	1
Madrid, ES	1
Provo, US	1
WTUlocation not on record	1
GJOlocation not on record	1
Tilburg, NL	1
Barcelona, ES	1
Badajoz, ES	1
Granada, ES	1
Pamplona, ES	1
Sevilla, ES	1
CASlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

51 institutions · 282 of 301 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pistacia atlantica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pistacia atlantica

At a glance

Sources13 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment13

Physiology & chemistry2

Other traits2

Compound class profile5 classes

Documented compounds69 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 243 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions32 of 51 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 243 records