Piriqueta cistoides

(L.) Mey. ex Steud. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Turneraceae/Piriqueta

At a glance

Occurrence records1 248

Data sources8

Biological traits13

DNA specimens2

eDNA detections4

Sources8 archives

Databases and archives Piriqueta cistoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 248 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo de Várzea, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Palmeiral, Restinga, Vegetação Sobre Afloramentos Roc

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piriqueta cistoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF276315.1 ↗223 bp

ACGT

TCGAAACCAATGCATAGGCAGAACGACCCGCGAACATGTTGCAAAAACACGACTAGGAAGTCGGGTGCGGAGTGACATGCTTGTCTTGTC …

Piriqueta cistoides subsp. caroliniana Shore175 internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Piriqueta cistoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 146×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · croinout — Fernndez, A. 1987

CCDB · croinout — Lavia, G. I. & Fernandez, A. 1993

CCDB · ipcn-api-dl — Fernández, A. 1987. Estudios cromosómicos en Turnera y Piriqueta (Turneraceae). Bonplandia (Corrientes) 6: 1–21.

CCDB · ipcn-api-dl — Lavia, G. I. & A. Fernandez. 1993. Cariótipos y estudios meióticos en varias especies do Piriqueta (Turneraceae). Bonplandia (Corrientes) 7: 129–141.

CCDB · book-ipcn75-78 — Ornduff 1970a

CCDB · book-fedorov — Lewis W. H. et al. 1962

n 73×CCDB · croinout · CCDB · Cave1962

CCDB · croinout — Ornduff, R. 1970

CCDB · Cave1962 — Lewis et al. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 248 records

Wild obs. + sensor1 218

Museum / vouchered30

Origin

Native16

Range

Area of Occupancy AOO2 940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 672≤1 km 155≤10 km 43>10 km 65

935 georeferenced · 283 without coordinates

Open the mapobservation + sensor1 218

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFPElocation not on record	9
Altos de Pipe, VE	5
Chaguaramas, TT	4
Bronx, US	3
CEPLAClocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Saint Louis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1
Austin, US	1

11 institutions · 30 of 30 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Piriqueta cistoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Piriqueta cistoides

At a glance

Sources8 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 248 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 248 records