Pipturus argenteus

(G.Forst.) Wedd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Pipturus

At a glance

Occurrence records2 622

Data sources12

Biological traits54

DNA specimens14

eDNA detections10

Sources12 archives

Databases and archives Pipturus argenteus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 622 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources54 traits

Occurrence & distributionGBIF2 622 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB2n = 52

01Narrative

Pipturus argenteus, known as false stinger, native mulberry, white mulberry, white nettle, amahatyan (Chamorro), and ghasooso (Carolinian), is a small tree native to Malesia, Papuasia, northern and eastern Australia, Micronesia, Melanesia and Polynesia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology24

Fruit length5 mm

Fruit width5 mm

Fruit width max8 mm

Leaf length110 mm

Leaf length max258 mm

Leaf length min36 mm

Leaf size8 670 mm²

Leaf width42 mm

Leaf width max157 mm

Leaf width min10 mm

Petiole length5.5 cm

Plant height10 m

Plant height max12 m

Plant height min2 m

Seed length0.7 mm

Seed length max1 mm

Seed mass0.444 mg

⚠ sources differ — TRY: 0.444 mg · AusTraits: 0.401 mg · GIFT: 0.442 mg

Seed mass max0.442 mg

Seed mass min0.442 mg

Seed volume0.38 mm³

Seed volume max0.38 mm³

Seed volume min0.38 mm³

Seed width0.7 mm

Seed width max0.7 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flower colourgreen

Flowering timeyyyyyynnnnnn

Life formshrub or tree

Life spanperennial

Pollination syndromewind

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 010 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

⚠ sources differ — AusTraits: dry · GIFT: fleshy

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Shrub

Habitat GIFTdense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapeovate

Succulenceno

Woodinesswoody

Physiology & chemistry6

Leaf n29.26 mg/g

Leaf p3.8 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.1 mm²/mg

Wood density364 mg/cm³

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pipturus argenteus has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes6

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH357935.1 ↗609 bp

ACGT

CCTGCCAAGCAGAACAACCCGCGAACATGTTTAACAATCTCTCGGCGTGTTTGCGGCCCTTCGGGGCCTAAAACTCGCCTTGTGTTGGGG …

Pipturus argenteus isolate Pip10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL7★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pipturus argenteus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidypolyploid inferred

Chromosome records52–522n range52median52mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 523×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Krause 1931

CCDB · book-fedorov — LeCoq 1963

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 622 records

Wild obs. + sensor605

Museum / vouchered1 640

Cultivated / captive3

Other374

Origin

Native113

Range

Area of Occupancy AOO5 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 264≤1 km 81≤10 km 30>10 km 31

406 georeferenced · 199 without coordinates

Open the mapobservation + sensor605

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 120≤1 km 223≤10 km 369>10 km 95

807 georeferenced · 833 without coordinates

Open the institutions mapphysical evidence1 640

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	241
Canberra, AU	199
Smithfield, AU	114
Mount Annan, AU	109
Kew, GB	104
Museo Entomologico de Leonlocation not on record	93
Honolulu, US	51
Palmerston, AU	36
Paris, FR	34
Bronx, US	32
University of Stellenboschlocation not on record	28
BISHlocation not on record	24
Christchurch, NZ	24
Auckland, NZ	22
Armidale, AU	13
Adelaide, AU	10
Fort Worth, US	10
MeiseBGlocation not on record	9
St. Paul, US	9
James Cook Townsvillelocation not on record	8
Saint Louis, US	7
Taipei, TW	7
Zürich, CH	5
Wellington, NZ	5
Cibinong, ID	4
Taipei, TW	4
South Kensington, GB	4
Llocation not on record	4
University of Minnesotalocation not on record	3
Université de Strasbourglocation not on record	3
La Trobe Universitylocation not on record	2
Kensington, AU	2
John T. Waterhouse Herbariumlocation not on record	2
Edinburgh, GB	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	1
CASlocation not on record	1
HAWlocation not on record	1
Moscow State Universitylocation not on record	1
Wlocation not on record	1
Kunming, CN	1
Cambridge, US	1
Cambridge, US	1
IPA/SPlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

45 institutions · 1 236 of 1 640 vouchered records shown · 401 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Pipturus argenteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 21.8–24.3

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 24.5–28.4

Min temp (night)19.1 °C 17.3–21.6

Precipitation101 mm/mo 62.9–248

Air humidity63.8 % 54.1–68.7

Moisture balance-30.6 mm/mo

Vapour deficit1,023 Pa 851–1,279

Wind speed4.20 m/s

Cloud cover45.8 % 23.6–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pipturus argenteus

At a glance

Sources12 archives

Size & morphology24

Life cycle & reproduction9

Diet & foraging1

Habitat & environment14

Physiology & chemistry6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 622 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 622 records