Pipturus albidus

(Hook. & Arn.) A.Gray ex H.Mann · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Pipturus

At a glance

Occurrence records681

Data sources10

Biological traits65

DNA specimens1

eDNA detections13

Sources10 archives

Databases and archives Pipturus albidus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility681 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources65 traits

Occurrence & distributionGBIF681 records

Environmental DNA2 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Pipturus albidus, known as māmaki (sometimes waimea, for its resemblance to olomea) in Hawaiian and known as Waimea pipturus in English, is a species of flowering plant in the nettle family, Urticaceae, that is endemic to Hawaii. It inhabits coastal mesic, mixed mesic, and wet forests at elevations of 60 –. Māmaki is a small tree that reaches a height of 9 m and a trunk diameter of 0.3 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height4 m

⚠ sources differ — GIFT: 4 m · USDA: 3.05 m · TRY: 6.1 m

Life cycle & reproduction15

Coppice potentialNo

Deciduousnessevergreen

Flower conspicuousNo

Life formtree

Life spanperennial

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Habitat & environment18

Adapted to coarse textured soilsNo

Adapted to fine textured soilsNo

Adapted to medium textured soilsNo

BloatNone

Climatewet tropical

Climberself-supporting

Foliage colorDark Green

Foliage textureMedium

Fruit colourwhite

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Hedge toleranceLow

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza type0.000000588

Root depth min36 in

Small grainNo

Woodinesswoody

Physiology & chemistry15

Anaerobic toleranceLow

Cold stratification requiredYes

Fire resistantNo

Fire toleranceMedium

Frost free days min365 days

Leaf C:N ratio16.93 g/g

Leaf c381 mg/g

Leaf n16 mg/g

Leaf p0.8 mg/g

Nitrogen fixation levelNone

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Shade toleranceMedium

Specific leaf area (SLA)16.16 mm²/mg

Temperature min40 °F

Uses & economy10

Berry nut seed productNo

Christmas tree productNo

Fodder productNo

Lumber productYes

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productYes

Pulpwood productYes

Veneer productYes

Other traits6

Fall conspicuousNo

Fruit seed conspicuousYes

Fruit seed persistenceNo

Height at 20yr9.14 m

Planting density max640 per acre

Planting density min320 per acre

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pipturus albidus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections13

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY864899.1 ↗636 bpUSA

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCAAGCAGAACAACCCGCGAACATGTTTAACAATCTCTCGGCTTGTTTGCGGC …

Pipturus albidus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pipturus albidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 286×CCDB · book-fedorov

CCDB · book-fedorov — Skottsberg 1955

CCDB · book-fedorov — LeCoq 1963

n 145×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — NICHARAT, s . & G.W. GILLETT. 1970. A review of the taxonmy of Hawaiian Pipturus (Urticaceae) by anatomical and cytological evidence. Brittonia 22: 191-206.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type681 records

Wild obs. + sensor633

Museum / vouchered46

Fossil1

Other1

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 313≤1 km 64≤10 km 34>10 km 121

532 georeferenced · 101 without coordinates

Open the mapobservation + sensor633

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 4≤10 km 8

12 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	20
Claremont, US	9
Wellington, NZ	4
CJBGlocation not on record	2
South Kensington, GB	2
Christchurch, NZ	2
Kew, GB	1
Ann Arbor, US	1
Bronx, US	1
Paris, FR	1
Angwin, US	1
ASUlocation not on record	1
Auckland, NZ	1

13 institutions · 46 of 46 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Pipturus albidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter3.30 °C

Max temp (day)23.8 °C

Min temp (night)22.0 °C

Precipitation93.0 mm/mo

Air humidity58.7 %

Moisture balance-30.5 mm/mo

Vapour deficit1,138 Pa

Wind speed4.00 m/s

Cloud cover36.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)