Piper umbellatum
speciesAt a glance
Occurrence records4 967
Data sources13
Biological traits47
DNA specimens24
eDNA detections20
Sources13 archives
Databases and archives Piper umbellatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 967 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS61 compounds
Occurrence & distributionGBIF4 967 records
Environmental DNA2 datasets · 7 countries20 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Piper umbellatum est une espèce de plantes à fleurs de la famille des Piperaceae C'est une plante herbacée ou un arbuste de 1 à 4 m de haut aux feuilles alternes, cordiformes pouvant atteindre 35 cm de diamètre, aux minuscules fleurs blanches en épis. Originaire d'Amérique tropicale, on la trouve dans presque toutes les régions tropicales humides. Elle est utilisée en médecine traditionnelle.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology17
Fruit length45.5 mm
Fruit width5 mm
Leaf length240 mm
Leaf size38 124 mm²
Leaf width275 mm
Petiole length30 cm
Plant height2.83 m
⚠ sources differ — GIFT: 2.83 m · AusTraits: 2.5 m · TRY: 1.76 m
Plant height max2 m
Plant height min0.9 m
Seed length1.5 mm
Seed mass0.073 mg
⚠ sources differ — TRY: 0.073 mg · AusTraits: 0.115 mg · GIFT: 0.073 mg
Seed mass max0.073 mg
Seed mass min0.073 mg
Seed volume0.059 mm³
Seed volume max0.059 mm³
Seed volume min0.059 mm³
Seed width1 mm
Life cycle & reproduction9
Deciduousnessevergreen
Dispersal typeanimal
Flowering endvariable
Flowering startvariable
Flowering timennnyyyynnnnn
Life formsubshrub or shrub
Life spanperennial
Raunkiær life formphanerophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
⚠ sources differ — AusTraits: drupe · GIFT: other
Growth formshrub
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Restinga
Leaf compoundnesssimple
Leaf shapeorbicular peltate widely_ovate
Woodinesswoody
Physiology & chemistry7
Leaf c455 mg/g
Leaf n30.04 mg/g
Leaf p1.89 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)28.35 mm²/mg
Wood density308 mg/cm³
03Chemical composition61 compounds
Compounds documented for Piper umbellatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Plant xanthones10
Stigmastane steroids7
Flavonols7
Cinnamic acid amides6
Aporphine alkaloids5
Documented compounds61 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (3S,4aS,6aR,6aR,6bR,8aR,12aS,14aR,14bS)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,14a-tetradecahydropicen-3-ol | present | LOTUS | |
| 1,3,5,7-Tetrahydroxy-8-Isoprenylxanthone | present | NPASS | |
| 1,3,5-Trihydroxy-8-(3-methylbut-2-enyl)xanthen-9-one | present | NPASS | |
| 1,3,5-Trihydroxyxanthone | present | NPASS | |
| 1,3,7-Trihydroxy-2-(3-methylbut-2-enyl)-xanthone | present | NPASS | |
| 1,3,7-Trihydroxyxanthone | present | NPASS | |
| 1,5-Dihydroxyxanthone | present | LOTUS | |
| 10,15-Dihydroxy-14-methoxy-10-azatetracyclo[7.6.1.02,7.012,16]hexadeca-1(16),2,4,6,8,12,14-heptaen-11-one | present | LOTUS | |
| 10-Hydroxy-14,15-dimethoxy-10-azatetracyclo[7.6.1.02,7.012,16]hexadeca-1(16),2,4,6,8,12,14-heptaen-11-one | present | LOTUS |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper umbellatum has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes6
GenBank sequences10
eDNA detections20
Countries7
The DNA barcodea real sequence read deposited for this species
TGATGCCTATCAAAAACAAGATAGACCAAAGAGAACTCGTAAACCCTCGTTATTGGCCCGCCGCACGTGGGCGCATCGCTCTACGCGCGT …
Piper umbellatum voucher ATREE_no_voucher internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Piper umbellatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records24–282n range26median26mode11records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 266×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1
CCDB · ipcn-api-dl — Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. Cytology and its bearing on the systematics and phylogeny of the Piperaceae. Cytologia 64: 301–307.
CCDB · ipcn-api-dl — Mathew, P. J. & P. M. Mathew. 1999. Karyomorphological studies in Heckeria subpeltata. J. Cytol. Genet. 34(2): 115–117.
CCDB · ipcn-api-dl — Okada, H. 1986. Karyomorphology and relationships in some genera of Saururaceae and Piperaceae. Bot. Mag. (Tokyo) 99: 289–299.
CCDB · book-ipcn75-78 — Ono 1975
CCDB · book-ipcn75-78 — Ono 1977a
CCDB · book-indian_vol1 — Mathew, P.M. 1958b
2n 244×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-indian_vol1 — Palm, B. 1915 (Tischler, G. 1927) ; Johansen, D.A 1931
CCDB · book-fedorov — Palm 1915 (T. 1927)
CCDB · book-fedorov — Johansen 1931b
CCDB · book-atlas-flowering-plants — Johansen 193lb
2n 281×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Gadella 1977d
n 131×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. Cytology and its bearing on the systematics and phylogeny of the Piperaceae. Cytologia 64: 301–307.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 967 records
Wild obs. + sensor1 387
Museum / vouchered3 363
Other217
Origin
Native286
Range
Area of Occupancy AOO11 092 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 684≤1 km 171≤10 km 90>10 km 64
1 009 georeferenced · 378 without coordinates
Open the mapobservation + sensor1 387
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 247≤1 km 81≤10 km 75>10 km 33
436 georeferenced · 2 927 without coordinates
Open the institutions mapphysical evidence3 363
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions102 of 256 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 487 |
| Chicago, US | 286 |
| Kew, GB | 135 |
| Plocation not on record | 106 |
| MeiseBGlocation not on record | 98 |
| Durango, MX | 98 |
| Mexico City, MX | 60 |
| JBRJlocation not on record | 56 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 52 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 52 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 52 |
| Bronx, US | 51 |
| Antiguo Cuscatlán, SV | 50 |
| National Biodiversity Institute, Costa Ricalocation not on record | 49 |
| WAGlocation not on record | 47 |
| Smithfield, AU | 43 |
| University of Stellenboschlocation not on record | 42 |
| Salvador, BR | 36 |
| Brisbane, AU | 36 |
| Universidad de Antioquia (UdeA)location not on record | 30 |
| Blumenau, BR | 29 |
| Yaoundé, CM | 28 |
| LBVlocation not on record | 28 |
| Austin, US | 27 |
| Canberra, AU | 26 |
| Tuxtla Gutiérrez, MX | 24 |
| Universidad de Caldas (UCaldas)location not on record | 23 |
| Berlin, DE | 21 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 21 |
| CASlocation not on record | 21 |
| CJBGlocation not on record | 21 |
| Glocation not on record | 19 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 19 |
| INMAlocation not on record | 18 |
| Herbier National du Gabonlocation not on record | 17 |
| Museo Entomologico de Leonlocation not on record | 17 |
| Loja, EC | 16 |
| Cenargenlocation not on record | 15 |
| León, NI | 15 |
| Ivano-Frankivsk, UA | 15 |
| Brasília, BR | 15 |
| Istituto Agrario Castelnuovolocation not on record | 14 |
| UFMGlocation not on record | 14 |
| UnBlocation not on record | 14 |
| USP-IBlocation not on record | 13 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| Autlán de Navarro, MX | 12 |
| San José, CR | 11 |
| CEPLAClocation not on record | 11 |
| ESALQlocation not on record | 11 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 11 |
| Chapingo, MX | 11 |
| Chaguaramas, TT | 11 |
| UFBAlocation not on record | 11 |
| Tampa, US | 10 |
| South Kensington, GB | 10 |
| Universiti Sains Malaysialocation not on record | 10 |
| Instituto do Meio Ambientelocation not on record | 10 |
| MAlocation not on record | 10 |
| Mexico City, MX | 10 |
| Ann Arbor, US | 10 |
| UFOPlocation not on record | 9 |
| Fort Worth, US | 9 |
| Paris, FR | 9 |
| Uppsala, SE | 9 |
| Stockholm, SE | 8 |
| Laboratorio de Ictiologialocation not on record | 8 |
| CNF-UFHBlocation not on record | 8 |
| UFAClocation not on record | 8 |
| Brasília, BR | 8 |
| Dresden, DE | 7 |
| Chongqing Museumlocation not on record | 7 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 7 |
| QCNElocation not on record | 7 |
| Madison, US | 7 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 7 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 6 |
| TAIElocation not on record | 6 |
| Université du Lomélocation not on record | 6 |
| MEXUlocation not on record | 6 |
| HUAlocation not on record | 6 |
| UTPLlocation not on record | 6 |
| Universidad Industrial de Santander (UIS)location not on record | 6 |
| Brussels, BE | 6 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 6 |
| Altos de Pipe, VE | 6 |
| St. Augustine, TT | 5 |
| UNICAMPlocation not on record | 5 |
| Jataí / Setor Industrial, BR | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 5 |
| Guatemala City, GT | 5 |
| Instituto de Investigação Científica Tropicallocation not on record | 5 |
| Mount Annan, AU | 5 |
| Area de Conservacion Guanacastelocation not on record | 5 |
| Universidade de São Paulolocation not on record | 5 |
| BRLUlocation not on record | 5 |
| Feira de Santana, BR | 5 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 5 |
| Taipei, TW | 5 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 5 |
| Philadelphia, US | 5 |
| Limbe Botanical & Zoological Gardenslocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| UEPAlocation not on record | 4 |
| TAFORI-LSRClocation not on record | 4 |
| Cascavel, BR | 4 |
| Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| Frankfurt am Main | 4 |
| Edinburgh, GB | 4 |
| Ciudad de México, MX | 4 |
| Tapachula, MX | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| UFESlocation not on record | 4 |
| UNEMATlocation not on record | 4 |
| Boise, US | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| Arusha, TZ | 4 |
| Bloomington, US | 4 |
| UNESP-RClocation not on record | 3 |
| UJLOGlocation not on record | 3 |
| UNESClocation not on record | 3 |
| Davis, US | 3 |
| UFMSlocation not on record | 3 |
| Xiamen, CN | 3 |
| UTFPR-DVlocation not on record | 3 |
| Mérida, MX | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Ilhéus, BR | 3 |
| Leiden University Medical Centerlocation not on record | 3 |
| Campo Mourão, BR | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Coimbra, PT | 3 |
| Juriquilla, MX | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| HUENFlocation not on record | 3 |
| Riverside, US | 3 |
| UNESP-FCAlocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Palmerston, AU | 2 |
| Montréal, CA | 2 |
| Minia, EG | 2 |
| La Paz, BO | 2 |
| Austin, US | 2 |
| Cambridge, US | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| Cincinnati, US | 2 |
| IPHAMETRAlocation not on record | 2 |
| Provincial Museum of Albertalocation not on record | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Cibinong, ID | 2 |
| James Cook Townsvillelocation not on record | 2 |
| OTSlocation not on record | 2 |
| UFSJlocation not on record | 2 |
| Zürich, CH | 2 |
| CUVClocation not on record | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| UFPElocation not on record | 2 |
| GZUlocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Corporación Universitaria Santa Rosa de Cabal (UNISARC)location not on record | 2 |
| UFSClocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| UNIVASFlocation not on record | 2 |
| Londrina, BR | 2 |
| Cambridge, US | 2 |
| UNIVILLElocation not on record | 2 |
| UESBlocation not on record | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| San Francisco, US | 2 |
| UNISANTAlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| National Herbarium of São Tomé and Principelocation not on record | 2 |
| Cusco, PE | 2 |
| Aarhus, DK | 2 |
| UFPIlocation not on record | 2 |
| IPA/SPlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Universidade de Passo Fundolocation not on record | 2 |
| Durham, US | 1 |
| Sanda, JP | 1 |
| University of Santo Tomas Museumlocation not on record | 1 |
| Montpellier, FR | 1 |
| UTFPR-SLlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Masindi, UG | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Santa Teresa, BR | 1 |
| UFVJMlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| UFPRlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Monastir, TN | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| CMULlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Universidad de Ibagué (UIbagué)location not on record | 1 |
| UFABClocation not on record | 1 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 1 |
| ASUlocation not on record | 1 |
| Puebla, MX | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Wlocation not on record | 1 |
| Mexico City, MX | 1 |
| University of the Sunshine Coastlocation not on record | 1 |
| DSMlocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Lake Charles, US | 1 |
| Bogotá, D.C., CO | 1 |
| Llocation not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Herbarium of the University of Neuchâtellocation not on record | 1 |
| Cuiabá, BR | 1 |
| Jardim Botânico do Rio de Janeirolocation not on record | 1 |
| BMlocation not on record | 1 |
| San Angelo, US | 1 |
| Universidad de Valparaísolocation not on record | 1 |
| GB | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Barcelona, ES | 1 |
| Pondicherry, IN | 1 |
| Centro Interdisciplinario de Investigacion para el Desarrollo Integral Regional Unidad Oaxacalocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| RBGlocation not on record | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| Dekalb, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Criciúma, BR | 1 |
| Fortaleza, BR | 1 |
| University of Comoroslocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Arequipa, PE | 1 |
| Riobamba, EC | 1 |
| Ciudad de México, MX | 1 |
| Andalas Universitylocation not on record | 1 |
| IECOSlocation not on record | 1 |
| Iquitos, PE | 1 |
| US | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Dublin, IE | 1 |
| UFRPElocation not on record | 1 |
256 institutions · 3 089 of 3 363 vouchered records shown · 268 without an institution code
09Environmental DNA20 detections
Where the DNA of Piper umbellatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map7 countries0
Humid temperate forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.8 °C 16.8–27.7
Seasonal swing summer↔winter3.30 °C
Max temp (day)27.8 °C 20.3–31.3
Min temp (night)21.4 °C 12.0–24.1
Precipitation137 mm/mo 53.6–403
Air humidity63.7 % 58.1–70.8
Moisture balance-23.6 mm/mo -94.9–264
Vapour deficit1,003 Pa 715–1,523
Wind speed2.30 m/s 1.80–3.60
Cloud cover33.8 % 25.4–39.2
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.