Piper mestonii

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Piperaceae/Piper

At a glance

Occurrence records234

Data sources5

Biological traits22

DNA specimens1

eDNA detections1

Sources5 archives

Databases and archives Piper mestonii's data was compiled from.

GBIFGlobal Biodiversity Information Facility234 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF234 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length45 mm

Fruit width16 mm

Leaf length195 mm

Leaf width40 mm

Petiole length4.75 cm

Seed length2 mm

Seed mass1.35 mg

Seed width1 mm

Life cycle & reproduction4

Flowering timennnynnnnnnnn

Life formclimber

Life spanperennial

Sex typedioecious

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formclimber

Leaf compoundnesssimple

Leaf shapenarrowly_ovate

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper mestonii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH493446.1 ↗636 bpIndonesia

ACGT

TTGATGCCCAACGGAACCAAGACAGACGTAAGCGAACTTGTGAACCGTCGTTCTCGGCCCGCACGCGGGGCGGCGCTCTGCGCGTGTCGG …

Piper mestonii voucher RA 189 clone 1_E1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type234 records

Wild obs. + sensor12

Museum / vouchered183

Cultivated / captive1

Other38

Origin

Native6

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced · 7 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 20≤1 km 12≤10 km 32>10 km 14

78 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence183

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	45
Smithfield, AU	32
Museo Entomologico de Leonlocation not on record	14
Honolulu, US	13
Canberra, AU	8
BISHlocation not on record	6
Mount Annan, AU	5
St. Paul, US	5
Saint Louis, US	3
Palmerston, AU	3
Bronx, US	2
Cibinong, ID	2
Paris, FR	1
Cambridge, US	1
James Cook Townsvillelocation not on record	1
Kew, GB	1
University of Stellenboschlocation not on record	1

17 institutions · 143 of 183 vouchered records shown · 40 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Piper mestonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)