Piper marginatum
Jacq. · speciesAt a glance
Occurrence records3 579
Data sources10
Biological traits20
DNA specimens31
eDNA detections14
Sources10 archives
Databases and archives Piper marginatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 579 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources20 traits
Chemical compositionLOTUS · NPASS78 compounds
Occurrence & distributionGBIF3 579 records
Environmental DNA1 datasets · 2 countries14 detections
DNA & barcodingBOLD · NCBI31 specimens
01Narrative
Piper marginatum est une espèce de plantes à fleurs de la famille des Piperaceae. C'est un arbrisseau néotropical commun dans les zones rudérales ombragées. Il est commun sur le littoral guyanais, où on le connaît sous les noms de ti bombe, feuille bombe (Créole), utiuti kamwi (Palikur), pimenta-do-mato, Santa-Barbara (Portugais), pikin man lembelembe (Aluku), ou encore ailleurs cake bush, Anesi wiwiri, marigold pepper (anglais), Hinojo(espagnol).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Plant height max4 m
Plant height min2 m
Seed mass0.185 mg
Seed mass max0.29 mg
Seed mass min0.1 mg
Life cycle & reproduction5
Deciduousnessevergreen
Dispersal typeanimal
Life formshrub
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 350 m
Elevation min0 m
Epiphyteterrestrial
Growth formshrub
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial)
Woodinesswoody
03Chemical composition78 compounds
Compounds documented for Piper marginatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives14
Elemane sesquiterpenoids5
Acyclic monoterpenoids4
Cadinane sesquiterpenoids3
Stigmastane steroids3
Documented compounds78 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Caryophyllene | present | LOTUS | |
| (1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-[[(2S,3R,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-(4-ethenylphenoxy)oxane-3,4,5-triol | present | NPASS | |
| (3R,6E)-Nerolidol | present | LOTUS | |
| (E)-3-Phenyl-1-(pyrrolidino)-2-propen-1-one | present | LOTUS | |
| 1,3,5-trimethoxy-2-[(Z)-prop-1-enyl]benzene | present | LOTUS | |
| 1,3,5-Trimethoxy-2-prop-1-enylbenzene | present | LOTUS | |
| 1,3,5-Trimethoxy-2-propenylbenzene | present | LOTUS |
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper marginatum has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes6
GenBank sequences10
eDNA detections14
Countries5
The DNA barcodea real sequence read deposited for this species
TATGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATCTTGGCAGCA …
Piper marginatum voucher 0118763817 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL10★rbcLa★ITS★ITS2trnH-psbA
plant barcodefungal barcodemarker
08Occurrence & distribution
Record type3 579 records
Wild obs. + sensor783
Museum / vouchered2 689
Cultivated / captive1
Other106
Origin
Native221
Range
Area of Occupancy AOO6 704 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 178≤1 km 46≤10 km 23>10 km 28
275 georeferenced · 508 without coordinates
Open the mapobservation + sensor783
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy71% within 1 km
≤100 m 177≤1 km 31≤10 km 60>10 km 24
292 georeferenced · 2 397 without coordinates
Open the institutions mapphysical evidence2 689
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions68 of 159 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 573 |
| Chicago, US | 358 |
| Bronx, US | 175 |
| Chaguaramas, TT | 93 |
| Instituto do Meio Ambientelocation not on record | 92 |
| Antiguo Cuscatlán, SV | 91 |
| National Biodiversity Institute, Costa Ricalocation not on record | 87 |
| Universidad de Antioquia (UdeA)location not on record | 83 |
| Mexico City, MX | 66 |
| Durango, MX | 60 |
| Berlin, DE | 52 |
| University of Stellenboschlocation not on record | 50 |
| Universidad Nacional de Colombia (UNAL)location not on record | 45 |
| Mérida, MX | 34 |
| Altos de Pipe, VE | 33 |
| Museu Paraense Emílio Goeldilocation not on record | 30 |
| UFPElocation not on record | 25 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 25 |
| Austin, US | 24 |
| JBRJlocation not on record | 23 |
| Tuxtla Gutiérrez, MX | 21 |
| Kew, GB | 18 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 18 |
| Departamento de Sistematica e Ecologialocation not on record | 17 |
| Tampa, US | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 16 |
| Riverside, US | 15 |
| Madison, US | 14 |
| León, NI | 13 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 13 |
| Philadelphia, US | 12 |
| Miami, US | 12 |
| Santarém, BR | 12 |
| Cambridge, US | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 11 |
| San José, CR | 11 |
| Austin, US | 11 |
| Area de Conservacion Guanacastelocation not on record | 10 |
| Universidad de Nariño (UdeNar)location not on record | 10 |
| Universidad de Ibagué (UIbagué)location not on record | 9 |
| CASlocation not on record | 9 |
| South Kensington, GB | 9 |
| Fort Worth, US | 8 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 8 |
| Universidad de La Salle (La Salle)location not on record | 8 |
| Cenargenlocation not on record | 7 |
| Universidad Industrial de Santander (UIS)location not on record | 7 |
| HUAlocation not on record | 7 |
| MEXUlocation not on record | 7 |
| UEPAlocation not on record | 7 |
| Xiamen, CN | 7 |
| Salvador, BR | 7 |
| MAlocation not on record | 6 |
| UFBAlocation not on record | 6 |
| St. Paul, US | 6 |
| Tapachula, MX | 6 |
| Museo de Historia Natural de El Salvadorlocation not on record | 5 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 5 |
| Brasília, BR | 5 |
| BMlocation not on record | 5 |
| Aarhus, DK | 5 |
| Cambridge, US | 5 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| Universidad Nacional Agrarialocation not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Sangmiung Universitylocation not on record | 4 |
| UFMGlocation not on record | 4 |
| Brasília, BR | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 3 |
| UnBlocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Feira de Santana, BR | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Claremont, US | 3 |
| Mérida, MX | 3 |
| QCNElocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Porto Velho, BR | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| University of Hamburglocation not on record | 3 |
| UFRRJlocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| St. Augustine, TT | 3 |
| Ann Arbor, US | 3 |
| Minia, EG | 3 |
| Universidad de Córdoba (UniCórdoba)location not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| UNESP-RClocation not on record | 2 |
| OTSlocation not on record | 2 |
| UFRPElocation not on record | 2 |
| Cuiabá, BR | 2 |
| QAPlocation not on record | 2 |
| Chicago, US | 2 |
| INMAlocation not on record | 2 |
| UNIVASFlocation not on record | 2 |
| GB | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Boise, US | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Museum of Zoologylocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Mexico City, MX | 2 |
| San Francisco, US | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| Cincinnati, US | 2 |
| Frankfurt am Main | 2 |
| Station d'Ecologie de Lamtolocation not on record | 2 |
| UFPIlocation not on record | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| Universidad de los Llanos (UniLlanos)location not on record | 2 |
| Wlocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Davis, US | 1 |
| Universidade de Passo Fundolocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Loja, EC | 1 |
| Dekalb, US | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Quito, EC | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Guatemala City, GT | 1 |
| arosemena tola, EC | 1 |
| HEMlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Cusco, PE | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| San Juan College School of Science Math & Engineeringlocation not on record | 1 |
| Instituto de invertigación de recursos biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Stockholm, SE | 1 |
| Chapingo, MX | 1 |
| Paris, FR | 1 |
| ASUlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Masindi, UG | 1 |
| CJBGlocation not on record | 1 |
| Mexico City, MX | 1 |
| HACAMlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Londrina, BR | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UFMSlocation not on record | 1 |
| Durham, US | 1 |
| Jackson, US | 1 |
| NO DISPONIBLElocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Ciudad de México, MX | 1 |
159 institutions · 2 623 of 2 689 vouchered records shown · 65 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Piper marginatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.7 °C 23.8–25.2
Seasonal swing summer↔winter2.50 °C
Max temp (day)27.0 °C 26.6–27.4
Min temp (night)22.9 °C 21.2–23.1
Precipitation356 mm/mo 14.9–403
Air humidity70.8 % 63.4–73.4
Moisture balance203 mm/mo
Vapour deficit861 Pa 843–1,149
Wind speed3.10 m/s
Cloud cover33.8 % 18.8–39.5
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.