Piper longum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Piperaceae/Piper

At a glance

Occurrence records174

Data sources14

Biological traits16

DNA specimens19

eDNA detections18

Sources14 archives

Databases and archives Piper longum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS154 compounds

Occurrence & distributionGBIF174 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex685 Mbp

01Narrative

Le poivrier long est une espèce de plantes à fleur de la famille des Piperaceae. C'est une liane qui produit du poivre originaire d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height3 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formclimbing perennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation mean580 m

Elevation min100 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Mycorrhiza type0.0000163

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition154 compounds

Compounds documented for Piper longum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Piperidine alkaloids45

N-acyl amines19

Aporphine alkaloids10

Furofuranoid lignans9

Kavalactones and derivatives8

Documented compounds154 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Asarinin	present	LOTUS
(+-)-Fargesin	present	LOTUS
(-)-Asarinin	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-Kawain	present	LOTUS
(2E,4E)-1-(1-Pyrrolidinyl)-2,4-decadien-1-one	present	LOTUS
(2E,4E)-5-(2H-1,3-benzodioxol-5-yl)-N-[(5E)-10-methylundec-5-en-1-yl]penta-2,4-dienamide	present	NPASS
(2E,4E,12E)-13-(1,3-benzodioxol-5-yl)-N-[(2R)-butan-2-yl]trideca-2,4,12-trienamide	present	LOTUS
(2E,4E,12Z)-N-(2-Methylpropyl)-2,4,12-octadecatrienamide	present	LOTUS
(2E,4E,14E)-1-piperidin-1-yloctadeca-2,4,14-trien-1-one	present	LOTUS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper longum has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes6

GenBank sequences9

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR731271.1 ↗659 bp

ACGT

AGGAAGAAGAAGTCGTAACAAGTTTTTCGTAGGTGAACCTGCGGAAGGATCATTGTTGATGCCTATGAGAACAAGACAGACTGAAGCGAA …

Piper longum cultivar Viswam small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI

The complete instruction manual Piper longum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size684 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Piper longum0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidypolyploid inferred

Chromosome records24–602n range52median52mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 528×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Samuel, R. 1987. Chromosome numbers in Piper. Kew Bull. 42: 465–470.

CCDB · ipcn-api-dl — Samuel, R. & W. Morawetz. 1989. Chromosomal evolution within Piperaceae. Pl. Syst. Evol. 166: 105–117.

CCDB · ipcn-api-dl — Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. Cytology and its bearing on the systematics and phylogeny of the Piperaceae. Cytologia 64: 301–307.

CCDB · ipcn-api-dl — Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1998. Cytological studies in south Indian Piperaceae I. Piper. J. Cytol. Genet. 33(2): 149–153.

CCDB · book-indian_vol1 — Mathew, P.M. 1958b

CCDB · kew — Samuel R, Smith JB, Bennett MD. 1986. Nuclear DNA variation in Piper (Piperaceae). Canadian Journal of Genetics and Cytology 28: 1041-1043.

CCDB · Cave1958 — Mathew 1958a

2n 263×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Sampathkumar, R. 1981. In Chromosome number reports LXXII. Taxon 30: 696.

CCDB · book-indian_vol1 — Samuel, M.R.A. & Bavappa, K.V.A. 1981

2n 242×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Tjio, J.H. 1948

CCDB · book-atlas-flowering-plants — Tjio 1948

2n 442×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Samuel, M. R. A. & K. V. A. Bavappa. 1981. Chromosome numbers in the genus Piper. Curr. Sci. 50: 197–198.

TreeOfSex · plant — Goldblatt1979 ↗

2n 481×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Dasgupta, A. & Datta, P.C. 1976

2n 601×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bai, G. V. S. & D. Subramanian. 1985. Cytotaxonomical studies of south Indian Piperaceae. Cytologia 50: 583–592.

n 263×CCDB · ipcn-api-dl · CCDB · Cave1958 · TreeOfSex · plant

CCDB · ipcn-api-dl — Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. Cytology and its bearing on the systematics and phylogeny of the Piperaceae. Cytologia 64: 301–307.

CCDB · Cave1958 — Mathew 1958a

TreeOfSex · plant — Goldblatt1979 ↗

n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bai, G. V. S. & D. Subramanian. 1985. Cytotaxonomical studies of south Indian Piperaceae. Cytologia 50: 583–592.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type174 records

Wild obs. + sensor30

Museum / vouchered141

Other3

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 4≤1 km 7≤10 km 2

13 georeferenced · 17 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤1 km 21≤10 km 4>10 km 4

32 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	23
Paris, FR	20
Ischia Marine Centrelocation not on record	15
Kunming, CN	11
Guangzhou, CN	10
Guilin, CN	6
Edinburgh, GB	4
Beijing, CN	4
Saint Louis, US	3
Natural History Museum, Tribhuvan Universitylocation not on record	3
Nanjing, CN	3
St. Augustine, TT	3
Chengdu, CN	3
Kagoshima, JP	2
Bronx, US	2
Guangzhou, CN	2
University of Hamburglocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
St. Paul, US	1
Uppsala, SE	1
Burlington, US	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Pondicherry, IN	1
Auckland, NZ	1
云南省思茅市民族传统医药研究所location not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
UEPAlocation not on record	1
Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record	1
Port Elizabeth Museum (Bayworld)location not on record	1
Kew, GB	1

31 institutions · 129 of 141 vouchered records shown · 8 without an institution code

09Environmental DNA18 detections

Where the DNA of Piper longum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 27.5–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C 30.2–31.9

Min temp (night)23.6 °C 23.6–24.4

Precipitation137 mm/mo 137–257

Air humidity59.8 % 59.8–64.2

Moisture balance-8.90 mm/mo -8.90–115

Vapour deficit1,523 Pa 1,323–1,523

Wind speed2.20 m/s 1.90–2.70

Cloud cover38.6 % 27.1–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)