Piper hederaceum

(Miq.) C.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Piperaceae/Piper

At a glance

Occurrence records1 193

Data sources8

Biological traits39

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Piper hederaceum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources39 traits

Chemical compositionLOTUS · NPASS53 compounds

Occurrence & distributionGBIF1 193 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Piper huegelianum là một loài thực vật có hoa trong họ Hồ tiêu. Loài này được (Miq.) C. DC. miêu tả khoa học đầu tiên năm 1869.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology17

Fruit length6.5 mm

Fruit width6 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min60 mm

Leaf mass186 mg

Leaf mass per area43.77 g/m2

Leaf size5 152 mm²

⚠ sources differ — TRY: 5 152 mm² · AusTraits: 5 648 mm²

Leaf width51.4 mm

Leaf width max90 mm

Leaf width min20 mm

Petiole length2.75 cm

Plant height5.7 m

Plant height max10 m

Plant height min1 m

Seed length6 mm

Seed mass45 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennyyyynnnnnn

Life spanperennial

Pollination syndromefly

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Leaf compoundnesssimple

Leaf shapenarrowly_ovate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)25.81 mm²/mg

Wood density250 mg/cm³

03Chemical composition53 compounds

Compounds documented for Piper hederaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthracyclines6

Carbazole alkaloids6

Piperidine alkaloids4

N-acyl amines3

Simple indole alkaloids1

Documented compounds53 total

Tissue Source Quantified only

Compound	Amount	Source
(5R)-8,10-dihydroxy-2,5-bis(hydroxymethyl)-5-methylnaphtho[2,3-c]isochromene-7,12-dione	present	NPASS
(7S,9R,10R)-10-[(2S,4S,5S,6S)-4-(dimethylamino)-5-hydroxy-6-methyloxan-2-yl]oxy-9-ethyl-4,6,7,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
(7S,9R,10R)-7,10-bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-1,4,6,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
(7S,9R,10R)-7,10-Bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-4,6,9,11-tetrahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
1,3-Benzodioxole, 4,5-dimethoxy-7-(2-propenyl)-	present	LOTUS
1-(3-indolyl)-2R,3-dihydroxypropan-1-one	present	NPASS
2,4-Octadienamide, N-(2-methylpropyl)-, (E,E)-	present	LOTUS
[(2S)-2,3-dihydroxypropyl] 1-hydroxy-4-methylpyrrole-2-carboxylate	present	NPASS
AQRJZDXKNNHWLN-PORWWVMASA-N	present	NPASS
AUMGNUSJWBCZIZ-YEICJFCOSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper hederaceum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ308640.1 ↗4 860 bp

ACGT

GTCGGCAGCGTGTTGTGCACTTGCCCTACCTTGCGTAGGCTGCTTGGTGCGATGTCGGTTTTTGGGTGCCTGTGTCGGTACCGGCGATGG …

Piper hederaceum voucher Gray_9456 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 193 records

Wild obs. + sensor732

Museum / vouchered168

Cultivated / captive6

Other287

Origin

Native66

Range

Area of Occupancy AOO2 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 419≤1 km 86≤10 km 50>10 km 21

576 georeferenced · 156 without coordinates

Open the mapobservation + sensor732

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 13≤1 km 38≤10 km 53>10 km 40

144 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence168

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4>10 km 1

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	66
Canberra, AU	40
Museo Entomologico de Leonlocation not on record	34
Armidale, AU	8
James Cook Townsvillelocation not on record	3
Hobart, AU	2
Adelaide, AU	2
Smithfield, AU	2
Palmerston, AU	2
Bronx, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wollongong, AU	1
Philadelphia, US	1
ASUlocation not on record	1

15 institutions · 165 of 168 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Piper hederaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 20.7–20.7

Seasonal swing summer↔winter8.90 °C

Max temp (day)23.7 °C

Min temp (night)18.0 °C

Precipitation139 mm/mo

Air humidity58.8 %

Moisture balance16.6 mm/mo

Vapour deficit1,009 Pa

Wind speed2.50 m/s

Cloud cover25.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Piper hederaceum

At a glance

Sources8 archives

Size & morphology17

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile5 classes

Documented compounds53 total

At a glance

Record type1 193 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 193 records