Piper cubeba

L.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Piperaceae/Piper

At a glance

Occurrence records25

Data sources9

Biological traits6

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Piper cubeba's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS · NPASS261 compounds

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Le cubèbe est une espèce de plantes à fleurs de la famille des Piperaceae. C'est une épice originaire d'Asie du Sud-Est. Il porte aussi le nom de cubèche, embèbe, poivre à queue, poivre de Java ou encore poivre du Kissi. L'épice est obtenue à partir des baies, récoltées avant maturité, séchées et moulues. De la même famille que le poivre, son goût est généralement plus fort. Son emploi est fréquent dans les poudres de curry. Le cubébol, un sesquiterpène alcool au goût frais, a été identifié dans l'huile essentielle de la baie du cubèbe (15 %). Le cubèbe peut se consommer directement en mâchant la baie, il laisse un goût frais dans la bouche.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height5 m

Life cycle & reproduction1

Deciduousnessevergreen

Habitat & environment3

Climatewet tropical

Climberobligatory

Growth formclimber

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition261 compounds

Compounds documented for Piper cubeba across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Dibenzylbutyrolactone lignans25

Acyclic monoterpenoids25

Arylnaphthalene and aryltetralin lignans22

Menthane monoterpenoids $ Monocyclic monoterpenoids22

Menthane monoterpenoids15

Documented compounds261 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	NPASS
(+)-4-Carene	present	NPASS
(+)-alpha-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Caryophyllene	present	NPASS
(+)-Borneol acetate	present	NPASS
(+)-Camphene	present	NPASS
(+)-cis-Carveol	present	NPASS
(+)-cis-Isopulegone	present	LOTUS
(+)-germacrene A	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Piper cubeba has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH493316.1 ↗610 bpIndonesia

ACGT

TTGATGCCCATCTTAACAAGACAGACGGAAGCGAACTTGTGAACCCTCGTGTTCTTGGCCCGCACGTCGGGGCGGCGCTCTGCGCGTGTC …

Piper cubeba voucher RA 161 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS10

plant barcodefungal barcode

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Range

Area of Occupancy AOO52 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence25

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cibinong, ID	4
Saint Louis, US	4
Singapore Botanic Gardenslocation not on record	3
Salvador, BR	2
St. Augustine, TT	2
UFBAlocation not on record	1
Chinese Academy of Forestrylocation not on record	1
Sri Ramaswamy Memorial Universitylocation not on record	1
University of Hamburglocation not on record	1

9 institutions · 19 of 25 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Piper cubeba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)