Pinus sylvestris
speciesAt a glance
Occurrence records1 020 822
Data sources15
Biological traits140
DNA specimens67
eDNA detections45
Sources15 archives
Databases and archives Pinus sylvestris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 020 820 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics67 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources140 traits
Chemical compositionLOTUS · NPASS302 compounds
Occurrence & distributionGBIF · PBDB1 020 822 records
Environmental DNA1 datasets · 6 countries45 detections
DNA & barcodingBOLD · NCBI67 specimens
Genome at a glanceCCDB · GoaT · NCBI22.7 Gbp
Deep timePBDB2 fossils
01Narrative
Le Pin sylvestre est une espèce d'arbres de la famille des Pinaceae originaire d'Europe moyenne et septentrionale, d'Asie du Nord jusqu'en Sibérie orientale, ainsi que des montagnes du nord du Moyen-Orient. C'est une espèce à grande amplitude écologique et climatique, notamment l'une des plus importantes de la forêt boréale d'Eurasie. Son bois, lorsqu'il provient d'Europe du Nord ou de Russie, est souvent commercialisé sous l'appellation « pin du Nord ». L'ancienne appellation courante avant le XXe siècle était celle de « pin de Riga ».
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology16
Fruit length45 mm
Fruit width23 mm
Leaf length max50 mm
Leaf mass10.81 mg
Leaf size65.03 mm²
⚠ sources differ — TRY: 65.03 mm² · LEDA: 69.8 mm² · GIFT: 65.94 mm²
Leaf width1 mm
Leaf width max1 mm
Leaf width min1 mm
Plant height32.88 m
⚠ sources differ — GIFT: 32.88 m · LEDA: 35 m · USDA: 33.53 m · TRY: 9.73 m
Plant height generative27.5 m
Plant height max40 m
Plant height min3 m
Seed length4.17 mm
Seed mass6.24 mg
⚠ sources differ — TRY: 6.24 mg · LEDA: 8.5 mg · GIFT: 6.65 mg
Seed mass max10 mg
Seed mass min5.2 mg
Life cycle & reproduction34
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower conspicuousNo
Flowering endJun
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryModerate
Lifespan years527 years
⚠ sources differ — TRY: 527 years · GIFT: 350 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number11 196
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation mean1 950 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureMedium
Fruit colourbrown
Growth formtree
Growth form USDASingle Stem
Habitat GIFTforest, mountains
Hedge toleranceMedium
Known allelopathNo
Leaf formlinear
Leaf retentionYes
Low growing grassNo
Mycorrhiza typeectomycorrhizal
Root depth min20 in
Shape and orientationConical
Small grainNo
Woodinesswoody
Physiology & chemistry29
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Leaf C:N ratio39.41 g/g
Leaf c508 mg/g
Leaf dry-matter content (LDMC)403 mg/g
⚠ sources differ — TRY: 403 mg/g · LEDA: 284 mg/g
Leaf n13.23 mg/g
Leaf p1.29 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min24 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5 pH
Specific leaf area (SLA)4.51 mm²/mg
⚠ sources differ — TRY: 4.51 mm²/mg · LEDA: 5.19 mm²/mg · GIFT: 5.22 mm²/mg
Temperature min-36 °F
Wood density543 mg/cm³
⚠ sources differ — TRY: 543 mg/cm³ · GIFT: 497 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productYes
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productYes
Seeds per pound70 720 per lb
ToxicityNone
Veneer productNo
Other traits14
Defenseyes
Diaspore typeseed
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr9.14 m
Leaf marginentire
Leaf spinesyes
Leaf thornsno
Planting density max1 200 per acre
Planting density min430 per acre
Sla max5.23 mm²/mg
Sla min5.02 mm²/mg
03Chemical composition302 compounds
Compounds documented for Pinus sylvestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Neolignans21
Abietane diterpenoids18
Cinnamic acids and derivatives16
Labdane diterpenoids $ Norlabdane diterpenoids16
Flavonols15
Documented compounds302 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-3-Carene | present | LOTUS | |
| (+)-alpha-Carene | present | LOTUS | |
| (+)-alpha-Pinene | present | LOTUS | |
| (+)-beta-Phellandrene | present | NPASS | |
| (+)-Camphene | present | LOTUS | |
| (+)-Pinoresinol | present | NPASS | |
| (+)-taxifolin | present | LOTUS | |
| (+)-trans-Pinocarveol | present | NPASS | |
| (-)-alpha-Pinene | present | LOTUS |
05DNA & barcoding67 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pinus sylvestris has left across the world's sequence archives.
At a glance
DNA specimens67
Marker genes6
GenBank sequences10
eDNA detections45
Countries8
The DNA barcodea real sequence read deposited for this species
GTAACTCCTCAACCCGGGGTGCCACCTGAAGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACC …
Pinus sylvestris voucher KS23 HER0492 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK5★rbcL5★rbcLa★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Pinus sylvestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size22 748 280 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Pinus sylvestris22.75 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records18–242n range24median24mode66records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2465×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Baranec T., 1979: Karyologické štúdium niektorých druhov rodu Pinus L. - Biologia (Bratislava) 34/1: 3-13.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Kormuťák A., 1975: Karyological structure of some Pinus species. - Biologia (Bratislava) 30/7: 545-550.
CCDB · brit-fl — Styles, B.T., Khosla, P.K. Taxon 24: 143-146 (1975)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1560
CCDB · fl-europaea — LSvkvist, 1963
CCDB · mediterranean
CCDB · ipcn-api-dl — Tong, B. Q. & Z. Y. He. 1985. Study on Giemsa C-banding staining technique on Gymnosperms. Liaoning Jinji Lin Yanjousuo Yanjou Baogao Huibian (Coll. Res. Rep. Liaoning Econ. Forest. Inst.). 1984: 48–54. (In Chinese).
CCDB · ipcn-api-dl — Tong, B. Q. & Z. Y. Hao. 1986. Studies on Giemsa C-banding technique for the chromosomes of gymnospermous plants. Sci. Silv. Sin. 22: 116–122.
CCDB · ipcn-api-dl — Chen, K. y., K. Kondo, Y. l. Gui & F. x. Wang. 1989. Giemsa C-banded karyotype analysis in two species of Pinus Pp. 257--260 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Baranec, T. 1979. A karyological study of some species of the genus Pinus L. Biologia (Bratislava) 34: 3–13.
CCDB · ipcn-api-dl — Budargin, V. A. 1980. Karyotips of basic conifers species of Kazakhstan. Zashchitnoe lesorasvedenie i voprosy slekcyi v Severnom Kazakhstan. 11: 116–122.
CCDB · ipcn-api-dl — Hizume, M. 1988. Karyomorphological studies in the family Pinaceae. Mem. Fac. Educ. Ehime Univ., Ser. 3, Nat. Sci. 8: 1–108.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Chang, H. & M. Li. 1982. Karyotype analysis of "Mongolian pine" from north-eastern China. Bull. Bot. Res., Harbin 2: 123–130.
CCDB · ipcn-api-dl — Muratova, E. N. 1986. In Kozubov, G.M. & E.N. Muratova, Sovremennye golosemennye (morfologo-sistematicheskii obzor i kariologiia). Leningrad, Izdatel'stvo Nauka.
CCDB · ipcn-api-dl — Kalashnik, N. A. & L. P. Presnuchina. 1989. Kharacteristika karyotipov populacij sosny obyknovennoj Bashkirskoj ASSR. Pp. 34--35 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Muratova, E. N. 1991. Chromosomal mutations in Pinus sylvestris L. at southern Zabaikalje. Izv. Akad. Nauk SSSR, Ser. Biol. 1991: 689–699.
CCDB · ipcn-api-dl — Chen, T. h., R. j. Wu, H. l. Lai & K. y. Li. 1992. A preliminary study on cytology taxonomy and system evolution of pine. J. Fujian Coll. Forest. 12: 437–444.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Fuchs, J., A. Brandes & I. Schubert. 1995. Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227–241.
CCDB · ipcn-api-dl — Pimenov, A. V. & T. S. Sedelnikova. 2002. Chromosome numbers of some Pinaceae from western and middle Siberia. Bot. Žhurn. (Moscow & Leningrad) 87(9): 136–137.
CCDB · ipcn-api-dl — Petrova, A. 2006. Mediterranean chromosome number reports 16 (1584--1603). Fl. Medit. 16: 431–442.
CCDB · ipcn-api-dl — Butorina. 2005. Variability of the cytological parameters of Pinus sylvestris L. seeds from the unique Hrenovskoy pine forest. Genetika 41: 778–783.
CCDB · ipcn-api-dl — Sedelnikova. 2002. Cytogenetic features of woody plants adaptation in extreme environmental conditions. Bjul. Derzhavn. Nikitsk. Bot. Sadu 86: 61–62.
CCDB · ipcn-api-dl — Muratova. 2005. Caryological and cytogenetic studies of coniferous plants of Siberia and Far East. Sibirskii Ëkol. Žur. 12(5): 573–582.
CCDB · ipcn-api-dl — Sedelnikova. 2001. Pecularities of nucleolus-forming chromosomes and structural rearrangements in the karyotype of swamp populations of pine. Sibirskii Ëkol. Žur. 6: 689–695.
CCDB · ipcn-api-dl — Chang, H. F. & M. X. Li. 1984. Study of karyotypes of three species of Pinus. Dongbei Linye Yanjou Shuo Xuebao, Liaoning (J. N.-E. Forest. Inst.). 12, Suppl.: 115–120. (In Chinese).
CCDB · ipcn-api-dl — Sedelnikova, T. S. & E. N. Muratova. 1989. Karyologicheskoe isuchenie sosny bolotnoy is Tomskoy Oblasti. Pp. 35--37 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Sedelnikova. 2000. Karyological features of conifers of swamp and dry valley of western Siberia. Krylovia 2(1): 73–80.
CCDB · ipcn-api-dl — Muratova, E. N., N. S. Medvedeva & T. S. Sedelnikova. 1991. Chromosome numbers in some members of the Pinaceae family. Bot. Žhurn. (Moscow & Leningrad) 76: 140–141.
CCDB · ipcn-api-dl — Pimenov. 2003. Chromosome numbers of some Cupressaceae and Pinaceae species. Bot. Žhurn. (Moscow & Leningrad) 88(10): 136–137.
CCDB · book-ipcn67-71 — SHISHNIASHVILI, R.M. 1968. A karyotypic analysis of Pinus sosnovskyi Nakai. (In Russian) Citologija 10: 255-25S:--
CCDB · book-ipcn75-78 — Uhrikova & Vachova 1974
CCDB · book-ipcn75-78 — Styles & Khosla 1975
CCDB · book-ipcn75-78 — Kormutak 1975
CCDB · book-ipcn75-78 — Kormutak 1976
+14 more references
2n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Abaturova, G. A. & A. A. Vishnyakov. 1980. Karyotype of Pinus sylvestris L. subsp. lapponica Fries. Citologija 14 (4): 36–40.
n 122×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — RUNQUIST, E.W. 1968. Meiotic investigations in Pinus sylvestris (L.). Hereditas 60: 77-128. ~~-
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelContig
07Deep time0.13–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range0.13–0.01 Ma Pleistocene
Dated fossil finds2
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Pinus sylvestris. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
08Occurrence & distribution
Record type1 020 822 records
Wild obs. + sensor943 989
Museum / vouchered40 269
Cultivated / captive32 541
Fossil417
Other3 606
Origin
Native2 263
Introduced12 946
Range
Area of Occupancy AOO896 528 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 296 261≤1 km 205 010≤10 km 281 789>10 km 3 617
786 677 georeferenced · 157 312 without coordinates
Open the mapobservation + sensor943 989
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy30% within 1 km
≤100 m 1 540≤1 km 8 910≤10 km 23 440>10 km 556
34 446 georeferenced · 5 823 without coordinates
Open the institutions mapphysical evidence40 269
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy35% within 1 km
≤100 m 16≤1 km 4≤10 km 28>10 km 9
57 georeferenced · 32 484 without coordinates
Open the mapnot free-living32 541
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions143 of 268 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 31 440 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 848 |
| Görlitz, DE | 766 |
| Karlsruhe, DE | 655 |
| BFLlocation not on record | 558 |
| Moscow State Universitylocation not on record | 411 |
| LDlocation not on record | 366 |
| Helsinki, FI | 300 |
| UniKSlocation not on record | 282 |
| Salzburg, AT | 180 |
| University of Silesia in Katowicelocation not on record | 175 |
| BIO-UNIPIlocation not on record | 162 |
| SLU Artdatabankenlocation not on record | 92 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 85 |
| MeiseBGlocation not on record | 84 |
| Uniwersytet Warszawskilocation not on record | 83 |
| Oskarshamn, SE | 78 |
| Jyväskylä, FI | 78 |
| DBF-NHMDlocation not on record | 77 |
| Christchurch, NZ | 77 |
| Oulu, FI | 60 |
| Bergen, NO | 57 |
| Turku, FI | 54 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 54 |
| Mlocation not on record | 52 |
| MAlocation not on record | 50 |
| Tartu, EE | 44 |
| Zürich, CH | 43 |
| Toronto, CA | 42 |
| Irkutsk State Universitylocation not on record | 42 |
| Chongqing Museumlocation not on record | 42 |
| KMNlocation not on record | 41 |
| Entomological Society of Latvialocation not on record | 41 |
| South Kensington, GB | 37 |
| Bronx, US | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Bern, CH | 35 |
| BDBClocation not on record | 35 |
| Allentown, US | 32 |
| Berlin, DE | 30 |
| Vitoria, ES | 30 |
| València, ES | 29 |
| TROMlocation not on record | 28 |
| Jurica-Suchy Nature Museumlocation not on record | 27 |
| Provincia di Livornolocation not on record | 27 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 26 |
| Uniwersytet Opolskilocation not on record | 24 |
| University of New Hampshirelocation not on record | 24 |
| Auckland, NZ | 23 |
| Kuopio, FI | 22 |
| Denver, US | 21 |
| Barcelona, ES | 21 |
| CICYTEXlocation not on record | 20 |
| Wuzhou, CN | 19 |
| Tallinn, EE | 19 |
| Madrid, ES | 19 |
| Rotorua, NZ | 18 |
| Ann Arbor, US | 17 |
| Porvoo, FI | 16 |
| Wlocation not on record | 16 |
| Zürich, CH | 16 |
| SWlocation not on record | 15 |
| Madison, US | 15 |
| Millersville, US | 15 |
| BClocation not on record | 14 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Tampere, FI | 14 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 14 |
| Frankfurt am Main | 13 |
| TUR-Alocation not on record | 13 |
| Uppsala, SE | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 13 |
| San Sebastián, ES | 13 |
| Montréal, CA | 12 |
| Porrentruy, CH | 12 |
| Madrid, ES | 12 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| New Haven, US | 11 |
| Acadia Universitylocation not on record | 11 |
| Burlington, US | 11 |
| Trondheim, NO | 11 |
| Canadian Department of Agriculturelocation not on record | 11 |
| Kandalaksha State Nature Reservelocation not on record | 11 |
| Minia, EG | 10 |
| Canberra, AU | 10 |
| SZUlocation not on record | 10 |
| Dresden, DE | 10 |
| Macomb, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| College Park, US | 9 |
| Philadelphia, US | 9 |
| WTUlocation not on record | 9 |
| Olocation not on record | 8 |
| nbflocation not on record | 8 |
| Paris, FR | 8 |
| Ypsilanti, US | 8 |
| Mount Pleasant, US | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Salamanca, ES | 7 |
| Nanjing, CN | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| Philadelphia, US | 7 |
| Dekalb, US | 7 |
| Beijing, CN | 6 |
| Green Bay, US | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Tromso University Museumlocation not on record | 6 |
| Chicago, US | 6 |
| McWane Science Centerlocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Museo Achille Folettolocation not on record | 6 |
| IFR-DNFlocation not on record | 5 |
| Royal Botanic Garden Edinburghlocation not on record | 5 |
| Flagstaff, US | 5 |
| Tilburg, NL | 5 |
| Hudson, US | 5 |
| Santiago de Compostela, ES | 5 |
| Saint Louis, US | 5 |
| GZUlocation not on record | 5 |
| Uniwersytet Jagiellońskilocation not on record | 5 |
| Forssa, FI | 5 |
| SWE054location not on record | 5 |
| Ivano-Frankivsk, UA | 5 |
| Granada, ES | 5 |
| Logan, US | 5 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Kew, GB | 4 |
| Lincoln, US | 4 |
| Pullman, US | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Alicante, ES | 4 |
| Tampa, US | 4 |
| Hamilton, US | 4 |
| Edinburgh, GB | 4 |
| GJOlocation not on record | 4 |
| Corvallis, US | 4 |
| Tula State Universitylocation not on record | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Durham, US | 4 |
| WINlocation not on record | 4 |
| EL PASO, US | 3 |
| FFPRIlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Sion, CH | 3 |
| Honolulu, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Salvador, BR | 3 |
| ISAlocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Philadelphia, US | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Davenport, US | 3 |
| Mohonk Preservelocation not on record | 3 |
| Bangkok, TH | 3 |
| Vancouver, CA | 3 |
| Pamplona, ES | 3 |
| Austin, US | 3 |
| Porto Alegre, BR | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Santa Barbara, US | 2 |
| Washington, US | 2 |
| UoB-IBlocation not on record | 2 |
| H-Wolflocation not on record | 2 |
| BSBIlocation not on record | 2 |
| BISHlocation not on record | 2 |
| Guangzhou, CN | 2 |
| St. Paul, US | 2 |
| Bourges, FR | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Moscow, US | 2 |
| Shanghai, CN | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Pamplona, ES | 2 |
| Saint John, CA | 2 |
| Glarus, CH | 2 |
| Ivano-Frankove, UA | 2 |
| Frauenfeld, CH | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Cape Town, ZA | 2 |
| BRNUlocation not on record | 2 |
| Winterthur, CH | 2 |
| Whitewater, US | 2 |
| Fort Worth, US | 2 |
| Trois-Rivières, CA | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Blumenau, BR | 2 |
| Chicago, US | 2 |
| Wellington, NZ | 2 |
| Hobart, AU | 2 |
| Albuquerque, US | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Boise, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Fullerton, US | 1 |
| NBSIlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Chapel Hill, US | 1 |
| Staten Island, US | 1 |
| Edmonton, CA | 1 |
| CJBGlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Stockholm, SE | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Davis, US | 1 |
| New Brunswick, US | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| OLAlocation not on record | 1 |
| Lausanne, CH | 1 |
| Tulane Universitylocation not on record | 1 |
| Portland, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| FLADlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Xiamen, CN | 1 |
| Mexico City, MX | 1 |
| Portland, US | 1 |
| San Angelo, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Lubbock, US | 1 |
| Clemson, US | 1 |
| San Jose, US | 1 |
| UNINE:NEUlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Provo, US | 1 |
| UChlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Kingston, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Ojo, NG | 1 |
| Québec, CA | 1 |
| Armidale, AU | 1 |
| University of Wisconsinlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Royal Ontario Museumlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Knoxville, US | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Otaru, JP | 1 |
| NMBU:MINAlocation not on record | 1 |
| Badajoz, ES | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Waverly, US | 1 |
| Whitehorse, CA | 1 |
| Angwin, US | 1 |
| Göteborg, SE | 1 |
| The University of Arizonalocation not on record | 1 |
| Chicago, US | 1 |
| Bloomington, US | 1 |
| ASUlocation not on record | 1 |
| SIHUlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
268 institutions · 38 956 of 40 269 vouchered records shown · 1 174 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA45 detections
Where the DNA of Pinus sylvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found45
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 45 detections have coordinates
Open the map6 countries0
near lake shore.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.8 °C 8.00–15.2
Seasonal swing summer↔winter19.6 °C
Max temp (day)13.8 °C 9.90–19.4
Min temp (night)9.20 °C 4.60–11.8
Precipitation85.9 mm/mo 62.8–128
Air humidity62.6 % 58.3–66.3
Moisture balance8.50 mm/mo -23.5–88.3
Vapour deficit525 Pa 370–782
Wind speed3.80 m/s 2.60–7.50
Cloud cover52.0 % 40.9–64.9
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.