Pinna nobilis

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Ostreida/Pinnidae/Pinna

At a glance

Occurrence records5 646

Data sources13

Biological traits6

DNA specimens479

eDNA detections473

Sources13 archives

Databases and archives Pinna nobilis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 167 records↗

OBISOcean Biodiversity Information System1 479 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI473 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics479 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF · OBIS5 646 records

Environmental DNA2 datasets · 1 countries473 detections

DNA & barcodingBOLD479 specimens

Genome at a glanceGoaT · NCBI≈813 Mbp

01Narrative

Pinna nobilis, common name the noble pen shell or fan mussel, is a large species of Mediterranean clam, a marine bivalve mollusc in the family Pinnidae, the pen shells. Pinna gigas Chemnitz It reaches up to 120 cm of shell length.Zavodnik, D., Hrs-Brenko, M., & Legac, M. (1991). Synopsis of the fan shell P. nobilis L. in the eastern Adriatic sea. In the C. F. Boudouresque, M. Avon, & V. Gravez (Eds.), Les Especes Marines a Proteger en Mediterranee (pp. 169–178). Marseille, France: GIS Posidonie publ. It produces a rare manganese-containing porphyrin protein known as pinnaglobin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length120 cm

Life cycle & reproduction1

Max. longevity540 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max200 m

Depth min125 m

03Chemical composition54 compounds

Compounds documented for Pinna nobilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids9

Oleanane triterpenoids7

Gallotannins4

Polyether ionophores3

Dimeric phloroglucinols3

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Betulonic acid	present	NPASS
(14S,15R,19R)-14-[(10R,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione	present	NPASS
(14S,15S,19S)-14-[(10S,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione	present	NPASS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1S,3S,7S,10R,11S,14S,23S,24R,26R,31R,32S,33S,34R,35S)-11,34-dihydroxy-11,23,24,35-tetramethyl-16-methylidene-37,38,39,40,41-pentaoxa-21-azaoctacyclo[30.4.1.11,33.13,7.17,10.110,14.020,26.026,31]hentetraconta-20,29-diene-29-carboxylic acid	present	LOTUS
(2S)-2-ammonio-3-(4-hydroxyphenyl)propanoate	present	LOTUS
(3S,4aR,6aR,6bS,8aR,11R,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-ol	present	NPASS
(4aS,6aR,6aS,6bR,8aR,10R,12aR,14bR)-10-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	NPASS
(4S)-4-[(E,3R)-3-hydroxybut-1-enyl]-3,5,5-trimethylcyclohex-2-en-1-one	present	NPASS

05DNA & barcoding479 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pinna nobilis has left across the world's sequence archives.

At a glance

DNA specimens479

BINs4

Marker genes1

eDNA detections473

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P338 bp consensus449 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

3Gmostly conserved

4Gmostly conserved

9Cmostly conserved

18Tmostly conserved

34Cmostly conserved

43Tmostly conserved

45Amostly conserved

60Cmostly conserved

62Gmostly conserved

63Amostly conserved

75Tmostly conserved

81Amostly conserved

84Tmostly conserved

87Gmostly conserved

99Amostly conserved

105Gmostly conserved

108Amostly conserved

111Tmostly conserved

114Amostly conserved

117Gmostly conserved

121Tmostly conserved

123Gmostly conserved

126Cmostly conserved

132Gmostly conserved

139Cmostly conserved

144Amostly conserved

153Gmostly conserved

156Gmostly conserved

159Gmostly conserved

165Cmostly conserved

168Tmostly conserved

178Tmostly conserved

180Gmostly conserved

183Gmostly conserved

189Amostly conserved

201Tvariable

202Tmostly conserved

213Amostly conserved

225Tmostly conserved

228Gmostly conserved

246Amostly conserved

249Gmostly conserved

252Gvariable

255Cmostly conserved

261Tmostly conserved

315Tvariable

ATGGCTGTCGATTTAGCTATTTTTTCTCTTCATCTGGCTGGATTAGCTTCTATTTTTGGCGGAATTAATTTTATTGTTACAGCTCAGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 65 variants.

Diversity (π)2.2%

Haplotypes65

BINs3

Most divergent pair2.4%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pinna nobilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈812 772 625 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pinna nobilis0.81 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness32.5% BUSCO

08Occurrence & distribution

Record type5 646 records

Wild obs. + sensor5 298

Museum / vouchered181

Fossil1

Other166

Origin

Native323

Range

Area of Occupancy AOO7 288 km²

Depth

0–200 m sunlit1 403

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 126 m · 1 403 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 334≤1 km 1 449≤10 km 284>10 km 863

2 930 georeferenced · 2 368 without coordinates

Open the mapobservation + sensor5 298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 6≤1 km 17≤10 km 43>10 km 39

105 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	36
Cambridge, US	35
Provincia di Livornolocation not on record	13
Brussels, BE	12
Santa Barbara Museum of Natural Historylocation not on record	10
Barcelona, ES	10
RBINS-Scientific Heritagelocation not on record	9
Salzburg, AT	6
Paris, FR	6
Philadelphia, US	3
South Kensington, GB	3
CASlocation not on record	2
Helsinki, FI	2
Toronto, CA	2
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	1
Banyoles, ES	1
Natural History Museum of Utahlocation not on record	1
ARMS-MBONlocation not on record	1
Chongqing Museumlocation not on record	1
Frankfurt am Main	1

20 institutions · 155 of 181 vouchered records shown · 4 without an institution code

09Environmental DNA473 detections

Where the DNA of Pinna nobilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found473

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 473 detections have coordinates

Open the map1 country0

Marina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 16.2–16.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)18.0 °C

Min temp (night)14.5 °C

Precipitation79.2 mm/mo

Air humidity64.2 %

Moisture balance-60.7 mm/mo

Vapour deficit662 Pa

Wind speed5.80 m/s

Cloud cover57.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pinna nobilis

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Other traits2

Compound class profile5 classes

Documented compounds54 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 646 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 646 records