Pinguicula macrophylla

Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lentibulariaceae/Pinguicula

At a glance

Occurrence records255

Data sources9

Biological traits2

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Pinguicula macrophylla's data was compiled from.

GBIFGlobal Biodiversity Information Facility255 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF255 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT660 Mbp

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatesubtropical

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pinguicula macrophylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAB199770.1 ↗670 bp

ACGT

AAGGATCATTGTCGAATCTCACAACGAGCAGACCGCGCACATGTATATGCCGCACGGGGCTCCCGATGGACAGGTGCCTGCGCGCCTCCC …

Pinguicula macrophylla genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Pinguicula macrophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size659 561 204 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pinguicula macrophylla0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · pinguilcula +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Greilhuber. 2006. Smallest angiosperm genomes found in Lentibulariaceae, with chromosomes of bacterial size. Pl. Biol. (Stuttgart) 8(6): 770–777.

CCDB · pinguilcula — Greilhuber et al. (2006)

CCDB · kew — Greilhuber J, Borsch T, Müller K, Worberg A, Porembski S, Barthlott W. 2006. Smallest angiosperm genomes found in Lentibulariaceae with chromosomes of bacterial size. Plant Biology 8: 770-777

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type255 records

Wild obs. + sensor157

Museum / vouchered98

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 47≤1 km 31≤10 km 36>10 km 11

125 georeferenced · 32 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 59≤1 km 1≤10 km 1>10 km 2

63 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	56
Mexico City, MX	15
Austin, US	5
Mexico City, MX	3
Chapingo, MX	3
Chicago, US	2
Giardini Botanici Hanburylocation not on record	2
University of Stellenboschlocation not on record	2
Juriquilla, MX	2
CASlocation not on record	1
Bronx, US	1
San Luis Potosí, MX	1
Philadelphia, US	1
USP-IBlocation not on record	1
Chongqing Museumlocation not on record	1
Madison, US	1
ASUlocation not on record	1

17 institutions · 98 of 98 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pinguicula macrophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)