Pinanga tashiroi

Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Pinanga

At a glance

Occurrence records43

Data sources8

Biological traits26

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Pinanga tashiroi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Pinanga tashiroi is a species of palm tree in the family Arecaceae. It is a small tree, up to 5 m tall, swollen at base. It is a critically endangered species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length18 mm

Fruit width12 mm

Leaf length max2 100 mm

Plant height3 m

⚠ sources differ — GIFT: 3 m · TRY: 6 m

Plant height max4 m

Plant height min2 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Climatesubtropical

Climberself-supporting

Elevation max600 m

Elevation mean465 m

Elevation min330 m

Epiphyteterrestrial

Fruit colourred

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max20 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max700 cm

Shoot orientationerect

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pinanga tashiroi has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAB271396.1 ↗659 bpTaiwan

ACGT

CCTTGACCCGGATGAGGAAAGACCCACGAACATGTGAACGCAATGCGTCCGTGGTGGGGAAGGCATGGCCTACCCACCGCGTCGCCCCTC …

Pinanga tashiroi gene for ITS1, 5.8S rRNA, ITS2, complete sequence, specimen_voucher: Wei-Hsin Hu 3744, clone: 2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor30

Museum / vouchered13

Origin

Native1

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤1 km 1>10 km 29

30 georeferenced

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	8
Taipei, TW	3
Saint Louis, US	1
TAIElocation not on record	1

4 institutions · 13 of 13 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Pinanga tashiroi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)