Pimpinella saxifraga
speciesAt a glance
Occurrence records347 547
Data sources9
Biological traits45
DNA specimens42
eDNA detections24
Sources9 archives
Databases and archives Pimpinella saxifraga's data was compiled from.
GBIFGlobal Biodiversity Information Facility347 547 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources45 traits
Chemical compositionNPASS69 compounds
Occurrence & distributionGBIF347 547 records
Environmental DNA1 datasets · 8 countries24 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceGoaT4.1 Gbp
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Leaf mass190 mg
Leaf size2 637 mm²
Plant height0.413 m
⚠ sources differ — GIFT: 0.413 m · LEDA: 0.3 m · TRY: 0.15 m
Plant height generative0.32 m
Plant height max0.9 m
Plant height min0.15 m
Seed length2.67 mm
Seed mass1.17 mg
Seed mass max1.69 mg
Seed mass min1.07 mg
Seed volume0.38 mm³
Seed volume max0.38 mm³
Seed volume min0.38 mm³
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 120
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Habitat GIFTcrop fields, forest edges, mountains
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio20.11 g/g
Leaf c467 mg/g
Leaf dry-matter content (LDMC)233 mg/g
⚠ sources differ — TRY: 233 mg/g · LEDA: 286 mg/g
Leaf n21 mg/g
Leaf p1.66 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.84 mm²/mg
⚠ sources differ — TRY: 21.84 mm²/mg · LEDA: 14.1 mm²/mg · GIFT: 15.8 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition69 compounds
Compounds documented for Pimpinella saxifraga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids22
Flavones9
Germacrane sesquiterpenoids9
Flavonols8
Bisabolane sesquiterpenoids6
Documented compounds69 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-alpha-Pinene | present | NPASS | |
| (1R,2S,3S,6R,7S,10R,11S)-1,6,10-trimethyl-4,14-dioxatetracyclo[9.2.1.02,10.03,7]tetradecan-5-one | present | NPASS | |
| (1R,4S,5S)-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol | present | NPASS | |
| (1S,2S,4R,7E,11S,12R)-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one | present | NPASS | |
| (3R,3As,5aR,6R,9aS,9bS)-6-hydroxy-3,5a-dimethyl-9-methylidene-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one | present | NPASS | |
| (3R,3aS,5aR,6R,9bS)-6-hydroxy-3,5a,9-trimethyl-3,3a,4,5,6,7,8,9b-octahydrobenzo[g][1]benzofuran-2-one | present | NPASS | |
| (3R,3aS,5aR,6R,9R,9aS,9bS)-6,9-dihydroxy-3,5a,9-trimethyl-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one | present | NPASS | |
| (3R,3aS,7R,10E,11aS)-7-hydroxy-3,10-dimethyl-6-methylidene-3,3a,4,5,7,8,9,11a-octahydrocyclodeca[b]furan-2-one | present | NPASS | |
| (3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,4,5,6,8,9b-hexahydro-6-hydroxy-3,6,9-trimethylazuleno[4,5-b]furan-2(3H)-one | present | NPASS | |
| (3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,5,6,9b-tetrahydro-6-hydroxy-3,6,9-trimethyl-4H-cyclohepta(2,1-b:3,4-c')difuran-2(3H)-one | present | NPASS |
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimpinella saxifraga has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes7
GenBank sequences10
eDNA detections24
Countries9
The DNA barcodea real sequence read deposited for this species
GTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGACATGCCCCCAACCGCGCACCCCTAGAGGAGCGTGA …
Pimpinella saxifraga voucher 37929HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGoaT
The complete instruction manual Pimpinella saxifraga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 088 039 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Pimpinella saxifraga4.09 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× / 4× cytotypes
Chromosome records20–402n range28median20mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
08Occurrence & distribution
Record type347 547 records
Wild obs. + sensor331 241
Museum / vouchered15 540
Cultivated / captive353
Other413
Origin
Native18 698
Introduced53
Range
Area of Occupancy AOO428 136 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 70 585≤1 km 51 327≤10 km 108 746>10 km 2 120
232 778 georeferenced · 98 463 without coordinates
Open the mapobservation + sensor331 241
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 1 211≤1 km 2 896≤10 km 7 064>10 km 1 085
12 256 georeferenced · 3 284 without coordinates
Open the institutions mapphysical evidence15 540
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 11>10 km 21
32 georeferenced · 321 without coordinates
Open the mapnot free-living353
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions94 of 192 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 7 286 |
| Helsinki, FI | 689 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 672 |
| BFLlocation not on record | 587 |
| Moscow State Universitylocation not on record | 535 |
| LDlocation not on record | 433 |
| Olocation not on record | 414 |
| Salzburg, AT | 232 |
| Oulu, FI | 231 |
| Trondheim, NO | 231 |
| Bergen, NO | 216 |
| Uppsala, SE | 197 |
| Adam Mickiewicz University in Poznańlocation not on record | 147 |
| Uniwersytet Warszawskilocation not on record | 141 |
| Oskarshamn, SE | 141 |
| Turku, FI | 126 |
| KMNlocation not on record | 118 |
| TROMlocation not on record | 104 |
| Görlitz, DE | 99 |
| Tartu, EE | 90 |
| Jyväskylä, FI | 79 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 77 |
| TUR-Alocation not on record | 69 |
| BDBClocation not on record | 64 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 62 |
| Philadelphia, US | 59 |
| Barcelona, ES | 58 |
| València, ES | 58 |
| Kuopio, FI | 56 |
| Provincia di Livornolocation not on record | 55 |
| SLU Artdatabankenlocation not on record | 54 |
| MeiseBGlocation not on record | 54 |
| MAlocation not on record | 50 |
| Tallinn, EE | 50 |
| Berlin, DE | 46 |
| South Kensington, GB | 42 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 41 |
| BRNUlocation not on record | 39 |
| Granada, ES | 33 |
| Zürich, CH | 30 |
| Mlocation not on record | 28 |
| Zürich, CH | 26 |
| Salamanca, ES | 24 |
| Entomological Society of Latvialocation not on record | 23 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 22 |
| BClocation not on record | 22 |
| Frankfurt am Main | 20 |
| DBF-NHMDlocation not on record | 20 |
| Madison, US | 19 |
| Wlocation not on record | 19 |
| GZUlocation not on record | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 17 |
| Karlsruhe, DE | 16 |
| Porvoo, FI | 15 |
| Córdoba, ES | 14 |
| Saint John, CA | 14 |
| Université Lavallocation not on record | 14 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| Québec, CA | 11 |
| GJOlocation not on record | 11 |
| Pamplona, ES | 11 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 11 |
| PrivatHerblocation not on record | 10 |
| Vitoria, ES | 10 |
| Uniwersytet Opolskilocation not on record | 10 |
| Porrentruy, CH | 9 |
| SWlocation not on record | 9 |
| SZUlocation not on record | 9 |
| Frauenfeld, CH | 9 |
| Allentown, US | 9 |
| Chongqing Museumlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| St. Paul, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| UGentlocation not on record | 7 |
| Green Bay, US | 7 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 7 |
| Fulda, DE | 6 |
| NMBU:MINAlocation not on record | 6 |
| Acadia Universitylocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Tula State Universitylocation not on record | 6 |
| Jaén, ES | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Glarus, CH | 6 |
| Bourges, FR | 5 |
| LfUlocation not on record | 5 |
| Appalachian State Universitylocation not on record | 5 |
| Taipei, TW | 5 |
| CJBGlocation not on record | 5 |
| Ann Arbor, US | 5 |
| OLAlocation not on record | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Saint Louis, US | 4 |
| Missoula, US | 4 |
| Paris, FR | 4 |
| Dresden, DE | 4 |
| Gijón, ES | 4 |
| Göteborg, SE | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Kandalaksha State Nature Reservelocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| nbflocation not on record | 4 |
| Philadelphia, US | 4 |
| Edinburgh, GB | 4 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Dekalb, US | 3 |
| H-AkrKGlocation not on record | 3 |
| Stockholm, SE | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Madrid, ES | 3 |
| H-Schuhwlocation not on record | 3 |
| Pamplona, ES | 3 |
| National Museum Waleslocation not on record | 3 |
| Bangkok, TH | 3 |
| Montréal, CA | 2 |
| EL PASO, US | 2 |
| Sevilla, ES | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Rovaniemi, FI | 2 |
| Christchurch, NZ | 2 |
| Bronx, US | 2 |
| Trois-Rivières, CA | 2 |
| FLADlocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Lausanne, CH | 2 |
| Forssa, FI | 2 |
| Bloomington, US | 2 |
| Oswego, US | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Corvallis, US | 2 |
| BGBMlocation not on record | 2 |
| Boumlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| SNSNMClocation not on record | 2 |
| Sion, CH | 2 |
| Davenport, US | 1 |
| Bozeman, US | 1 |
| ROM007location not on record | 1 |
| STUlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| BIO-UNIPIlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Auckland, NZ | 1 |
| München, DE | 1 |
| CZE061location not on record | 1 |
| JBSlocation not on record | 1 |
| Xiamen, CN | 1 |
| Philadelphia, US | 1 |
| WTUlocation not on record | 1 |
| College Park, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| CJBNlocation not on record | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Northridge, US | 1 |
| Millersville, US | 1 |
| UNINE:NEUlocation not on record | 1 |
| UniKSlocation not on record | 1 |
| Alicante, ES | 1 |
| Banyoles, ES | 1 |
| New Haven, US | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| Boise, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| Tilburg, NL | 1 |
| Kew, GB | 1 |
| Durham, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Hudson, US | 1 |
| Logan, US | 1 |
| PRClocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Columbia, US | 1 |
| Toronto, CA | 1 |
| Sant Julià de Lòria, AD | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Podgorica, ME | 1 |
| DULlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Whitehorse, CA | 1 |
| Elikins, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
192 institutions · 14 580 of 15 540 vouchered records shown · 748 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Pimpinella saxifraga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map8 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.2 °C 13.3–19.0
Seasonal swing summer↔winter16.8 °C
Max temp (day)18.9 °C 15.0–24.1
Min temp (night)13.2 °C 8.70–15.5
Precipitation81.7 mm/mo 69.3–99.9
Air humidity61.7 % 58.3–65.0
Moisture balance-24.6 mm/mo
Vapour deficit715 Pa 469–910
Wind speed3.50 m/s
Cloud cover44.0 % 37.4–56.6
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.