Pimpinella major
(L.) Huds. · speciesAt a glance
Occurrence records151 005
Data sources13
Biological traits43
DNA specimens25
eDNA detections12
Sources13 archives
Databases and archives Pimpinella major's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility151 005 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Chemical compositionLOTUS · NPASS28 compounds
Occurrence & distributionGBIF151 005 records
Environmental DNA1 datasets · 4 countries12 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB · GoaT2.7 Gbp
01Narrative
Pimpinella saxifraga, le Petit boucage ou Boucage saxifrage, est une espèce de plantes à fleurs de la famille des Apiacées. C'est une plante herbacée originaire d'Eurasie. Les boucages, y compris l'anis vert, sont des Ombellifères à fleurs blanches ou rosées assez petites, fruits ovoïdes à cotes peu saillantes toutes égales entre elles, calice non apparent et feuilles composées de 5 à 11 folioles ovales grossièrement dentées. Il en existe en France plusieurs espèces. Les unes à fruits et partie supérieure de la plante sans poils; ce sont des Boucages saxifrages, dont l'un, à tige pleine et folioles petites, est le Pimpinella saxifraga Huds., et l'autre à tige creuse et grandes folioles, est le Grand boucage ou P. magnaL. Les autres espèces, toutes méridionales, ont les fruits et la tige entièrement velus ; ce sont l'Anis vert qui se distingue à son odeur d'Anis, et 2 espèces méditerranéennes, P. peregrina L. et P.tragium Villars, dont les propriétés sont approximativement les mêmes que celles des Boucages saxifrages.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass325 mg
Leaf size844 mm²
⚠ sources differ — TRY: 844 mm² · LEDA: 9 334 mm² · GIFT: 9 334 mm²
Plant height0.658 m
⚠ sources differ — GIFT: 0.658 m · LEDA: 0.625 m · TRY: 0.333 m
Plant height generative0.442 m
Plant height max1 m
Plant height min0.2 m
Seed length2.87 mm
Seed mass2.08 mg
Seed mass max2.69 mg
Seed mass min1.54 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
Flowering endSep
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number14 341
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, forest edges, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio17.76 g/g
Leaf c435 mg/g
Leaf dry-matter content (LDMC)242 mg/g
⚠ sources differ — TRY: 242 mg/g · LEDA: 207 mg/g
Leaf n27.5 mg/g
Leaf p3.67 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.71 mm²/mg
⚠ sources differ — TRY: 18.71 mm²/mg · LEDA: 28.6 mm²/mg · GIFT: 23.58 mm²/mg
Wood density48.12 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition28 compounds
Compounds documented for Pimpinella major across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones6
Plant xanthones5
Ursane and Taraxastane triterpenoids4
Secoiridoid monoterpenoids3
Bisabolane sesquiterpenoids2
Documented compounds28 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| (-)-Sweroside | present | NPASS | |
| (1R,4aS,6S,7R,7aS)-1,6-dihydroxy-7-methyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid | present | NPASS | |
| (3S,4R,4aS,5R)-4-ethenyl-5-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,4a,5,6-tetrahydro-3H-pyrano[3,4-c]pyran-8-one | present | NPASS | |
| (3S,4R,4aS,5S)-4-ethenyl-5-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,4a,5,6-tetrahydro-3H-pyrano[3,4-c]pyran-8-one | present | NPASS | |
| (4-hydroxy-2,6-dimethoxyphenyl)-[3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]methanone | present | NPASS | |
| (7Alpha-Hydroxy)-Morroniside | present | NPASS | |
| 1,3,6,8-tetrahydroxy-2-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]xanthen-9-one | present | NPASS | |
| 1,8-dihydroxy-5,6-dimethoxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxyxanthen-9-one | present | NPASS | |
| 2,6,8-trihydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyxanthen-9-one | present | NPASS |
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimpinella major has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes6
GenBank sequences10
eDNA detections12
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATC …
Pimpinella major voucher HAVR-2017-17 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Pimpinella major carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 728 620 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Pimpinella major2.73 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy2× diploid · measured
Chromosome records18–402n range28median40mode94records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4034×CCDB · ita-fl · CCDB · slov-fl · CCDB · brit-fl +7
CCDB · ita-fl — HUNKELER C., FAVARGER C. - 1967. Contribution la cytotaxonomie du genre Pimpinella L.. Bull. Soc. Neuchateloise Sci. Nat. , 90: 219-239.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Hindáková M. & Činčura F., 1968: Angaben über die Zahl und Morphologie der Chromosomen einiger Pflanzenarten aus dem Territorium der Ostslowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 181-227.
CCDB · slov-fl — Murín A. & Feráková V., 1986: Karyological study of the Slovak flora VIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 41-43.
CCDB · slov-fl — Váchová M. & Májovský J., 1978: [Report], pp. 381-382. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3253
CCDB · fl-europaea — Lovkvist , 1963
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · poland — Pogan E., Jankun A., Wcis?o H. et al. 1990. Further studies in chromosome numbers of Polish Angiosperms. Part XXIII. Acta Biol. Cracov. Ser. Bot. 32, 171-188.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Halkka, L. 1985. Chromosome counts of Finnish vascular plants. Ann. Bot. Fenn. 22: 315–317.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979. Chromosome numbers of some species of the family Apiaceae Lindl. II. Bot. Zhurn. 64 (2): 227–232.
CCDB · ipcn-api-dl — Hahn, B. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Murín, A. & V. Feráková. 1986. Karyological study of the Slovak flora VIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 41–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — HINDAKOVA, M., & F. CINCURA. 1967. Angaben Uber die Zahl und Morphologie der Chromosomen einiger Pf lanzenarten aus dem Territorium der Ostslowakei I. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 181-227.
CCDB · book-fedorov — Bell, Constance 1960
CCDB · book-fedorov — Hindakova (I. Slov. fl. I. 1967)
CCDB · CromoCat 2015 — Al-Bermani, A.-K. K. A., Al-Shammary, K. I. A., Gornall, R. J. & Bailey, J. P. (1993). Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169-171.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Hahn, B. (2000). In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants Verlag des Naturhistorischen Museums Wien Vienna
CCDB · CromoCat 2015 — Halkka, L. (1985). Chromosome counts of Finnish vascular plants. Ann. Bot. Fenn. 22: 315-317.
CCDB · CromoCat 2015 — Jurtseva, O. V. (1988). The cytologic study of some species of the genus Pimpinella L. (Umbelliferae--Apioideae) Biologicheskie Nauki (Alma-Ata) 11: 78-84
CCDB · CromoCat 2015 — Krasnikov, A. A. & Lomonosova, M. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region.I. Botani?eskij Žurnal (Moscow & Leningrad) 75: 116-118.
CCDB · CromoCat 2015 — Pogan, E. (1982b). Further studies in chromosome numbers of Polish angiosperms. Part XVI Acta Biol. Cracov., Ser. Bot. 24: 159–189
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Váchová, M. & J. Májovský. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 381-382.
2n 1824×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Javurkova, V. 1981. In Chromosome number reports LXXIII. Taxon 30: 856–857.
CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-northern-plants — Schulz-Gaebel 1930.
CCDB · book-fedorov — Schulz-Gaebel 1930
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — HAkansson 1953
CCDB · book-fedorov — Garde, Malheiros-Garde 1949
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — P6lya 1949
CCDB · book-atlas-flowering-plants — Hakansson 1953
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Javurková, V. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 856-857.
CCDB · CromoCat 2015 — Pogan, E. (1982b). Further studies in chromosome numbers of Polish angiosperms. Part XVI Acta Biol. Cracov., Ser. Bot. 24: 159–189
CCDB · CromoCat 2015 — Hunkeler, C. & Favarger, C. (1967). Contribution a la cytotaxinomie du genre Pimpinella L. Bull. Soc. Neuchâtel. Sci. Nat. 90: 219-239
CCDB · CromoCat 2015 — Jurtseva, O. V. (1988). The cytologic study of some species of the genus Pimpinella L. (Umbelliferae--Apioideae) Biologicheskie Nauki (Alma-Ata) 11: 78-84
CCDB · CromoCat 2015 — Uhrikova, A. (1978). In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1-42.
2n 2023×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — HUNKELER C., FAVARGER C. - 1967. Contribution la cytotaxonomie du genre Pimpinella L.. Bull. Soc. Neuchateloise Sci. Nat. , 90: 219-239.
CCDB · slov-fl — Váchová M. & Feráková V., 1980: [Report], pp. 722-723. - In: Löve Á. (ed.), Chromosome numbers reports LXIX, Taxon 29 /5-6.
CCDB · slov-fl — Hunkeler C. & Favarger C., 1967: Contribution ? la cytotaxonomie du genre Pimpinella L. - Bull. Soc. Neuchâteloise Sci. Nat. 90: 219-239.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3252
CCDB · fl-europaea — Baksay, 1957
CCDB · poland — Hunkeler C. and Favarger C. 1967. Contribution la cytotoxonomie de genre Pimpinella L. Bull. Soc. Neucht. Sci. Nat. 90, 219-239.
CCDB · ipcn-api-dl — Jurtseva, O. V. 1988. The cytologic study of some species of the genus Pimpinella L. (Umbelliferae--Apioideae). Biol. Nauki (Alma-Ata) 11: 78–84.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Vachova, M. 1974. Correction in Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Vachova, M. & V. Ferakova. 1980. In Chromosome number reports LXIX. Taxon 29: 722–723.
CCDB · book-fedorov — Bakay
CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Javurková, V. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 856-857.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Váchová, M. & V. Feráková. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 722-723.
CCDB · CromoCat 2015 — Hunkeler, C. & Favarger, C. (1967). Contribution a la cytotaxinomie du genre Pimpinella L. Bull. Soc. Neuchâtel. Sci. Nat. 90: 219-239
CCDB · CromoCat 2015 — Jurtseva, O. V. (1988). The cytologic study of some species of the genus Pimpinella L. (Umbelliferae--Apioideae) Biologicheskie Nauki (Alma-Ata) 11: 78-84
CCDB · iapt — IAPT/IOPB Chromosome Data 27
2n 3613×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-northern-plants — Hakansson 1933.
CCDB · book-fedorov — Wanscher 1933, 1934a
CCDB · book-fedorov — LOve A. 1951c
CCDB · kew — Mowforth MA.1986. Variation in nuclear DNA amounts in flowering plants: an ecological analysis. PhD. Thesis, University of Sheffield. Specific reference for Poa annua in Mowforth MA and Grime JP. 1989. Intra-Population Variation in Nuclear DNA Amount
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Jurtseva, O. V. (1988). The cytologic study of some species of the genus Pimpinella L. (Umbelliferae--Apioideae) Biologicheskie Nauki (Alma-Ata) 11: 78-84
CCDB · CromoCat 2015 — Pogan, E. (1982b). Further studies in chromosome numbers of Polish angiosperms. Part XVI Acta Biol. Cracov., Ser. Bot. 24: 159–189
n 1012×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · slov-fl — Hunkeler C. & Favarger C., 1967: Contribution ? la cytotaxonomie du genre Pimpinella L. - Bull. Soc. Neuchâteloise Sci. Nat. 90: 219-239.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Silvestre, S. 1993. Números cromosomáticos para la flora Española. 643--663. Lagascalia 17: 151–160.
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · CromoCat 2015 — Cauwet, A. M. (1968). Contribution a l'étude caryologique des Ombellifères de la partie orientale des Ptrénées. Naturalia Monspel., Sér. Bot. 19: 5-27.
CCDB · CromoCat 2015 — Silvestre, S. (1993). Números cromosómicos para la flora española. 643-663. Lagascalia 17(1): 151-160.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Belaeva, V. A. & Siplivinsky, V. N. (1975). Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žurn. 60: 864-872.
CCDB · CromoCat 2015 — Hunkeler, C. & Favarger, C. (1967). Contribution a la cytotaxinomie du genre Pimpinella L. Bull. Soc. Neuchâtel. Sci. Nat. 90: 219-239
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 209×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · slov-fl — Hunkeler C. & Favarger C., 1967: Contribution ? la cytotaxonomie du genre Pimpinella L. - Bull. Soc. Neuchâteloise Sci. Nat. 90: 219-239.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Alexeeva, T. V., M. G. Vasil'eva, J. V. Daushkevich & M. G. Pimenov. 1994. IOPB chromosome data 8. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 23: 11–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · CromoCat 2015 — Alexeeva, T. V., Vasileva, M. G., Daushkevich, J. V. & Pimenov, M. G. (1994). IOPB Chromosome Data 8 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 23 : 11-12.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Hunkeler, C. & Favarger, C. (1967). Contribution a la cytotaxinomie du genre Pimpinella L. Bull. Soc. Neuchâtel. Sci. Nat. 90: 219-239
n 186×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979. Chromosome numbers of some species of the family Apiaceae Lindl. II. Bot. Zhurn. 64 (2): 227–232.
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Belaeva, V. A. & Siplivinsky, V. N. (1975). Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žurn. 60: 864-872.
CCDB · CromoCat 2015 — Rostovtseva, T. S. (1976). Chromosome numbers of some species from the family Apiaceae in South Siberia. Bot. Žurn. 61: 93-99.
n 92×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. I Gard, A. & N. Malheiros-Gard.Agron. Lusit.11(2): 91-140(1949).
CCDB · CromoCat 2015 — Gardé, A. & Malheiros-Gardé, N. (1949). Contribuiçao para o estudo cariológico da familia Umbelliferae. I. Agron. Lusit. 11(2): 91-140.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type151 005 records
Wild obs. + sensor143 768
Museum / vouchered5 210
Cultivated / captive136
Other1 891
Origin
Native4 226
Introduced47
Range
Area of Occupancy AOO159 956 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy34% within 1 km
≤100 m 11 004≤1 km 25 980≤10 km 71 837>10 km 1 508
110 329 georeferenced · 33 439 without coordinates
Open the mapobservation + sensor143 768
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 465≤1 km 1 084≤10 km 1 997>10 km 106
3 652 georeferenced · 1 558 without coordinates
Open the institutions mapphysical evidence5 210
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 7>10 km 11
18 georeferenced · 118 without coordinates
Open the mapnot free-living136
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 120 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 969 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 465 |
| BFLlocation not on record | 344 |
| Salzburg, AT | 276 |
| LDlocation not on record | 179 |
| BIO-UNIPIlocation not on record | 130 |
| DBF-NHMDlocation not on record | 79 |
| Helsinki, FI | 76 |
| Tartu, EE | 74 |
| Karlsruhe, DE | 62 |
| Uppsala, SE | 53 |
| Oskarshamn, SE | 53 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| MAlocation not on record | 49 |
| MeiseBGlocation not on record | 44 |
| Bern, CH | 44 |
| Barcelona, ES | 42 |
| Entomological Society of Latvialocation not on record | 42 |
| Olocation not on record | 40 |
| South Kensington, GB | 37 |
| BDBClocation not on record | 34 |
| València, ES | 33 |
| Provincia di Livornolocation not on record | 32 |
| Turku, FI | 31 |
| Oulu, FI | 28 |
| Görlitz, DE | 23 |
| BClocation not on record | 20 |
| Kuopio, FI | 19 |
| Porrentruy, CH | 19 |
| Moscow State Universitylocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Berlin, DE | 18 |
| BRNUlocation not on record | 18 |
| Granada, ES | 18 |
| Salamanca, ES | 17 |
| SLU Artdatabankenlocation not on record | 17 |
| Wlocation not on record | 16 |
| Zürich, CH | 15 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Zürich, CH | 15 |
| Tallinn, EE | 13 |
| Mlocation not on record | 13 |
| Tilburg, NL | 10 |
| Córdoba, ES | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Glarus, CH | 9 |
| Trondheim, NO | 9 |
| GZUlocation not on record | 8 |
| Edinburgh, GB | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Beijing, CN | 7 |
| Madrid, ES | 7 |
| TROMlocation not on record | 7 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| LfUlocation not on record | 6 |
| Frauenfeld, CH | 6 |
| TUR-Alocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Pamplona, ES | 6 |
| GJOlocation not on record | 6 |
| Philadelphia, US | 5 |
| Bergen, NO | 5 |
| Gijón, ES | 5 |
| Paris, FR | 5 |
| Winterthur, CH | 4 |
| CJBGlocation not on record | 4 |
| Sion, CH | 4 |
| Dresden, DE | 4 |
| Christchurch, NZ | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Bourges, FR | 3 |
| Sant Julià de Lòria, AD | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Jyväskylä, FI | 3 |
| Nijmegen, NL | 3 |
| Tampere, FI | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Pamplona, ES | 3 |
| Vitoria, ES | 2 |
| Tromso University Museumlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Namur, BE | 2 |
| Jaén, ES | 2 |
| CJBNlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Taipei, TW | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| SZUlocation not on record | 2 |
| Podgorica, ME | 1 |
| Badajoz, ES | 1 |
| Xiamen, CN | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Québec, CA | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Sevilla, ES | 1 |
| Museo Achille Folettolocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| STUlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Brussel, BE | 1 |
| ULBF-AGRlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Saint Louis, US | 1 |
| KMNlocation not on record | 1 |
| WTUlocation not on record | 1 |
| AUT001location not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| NoColllocation not on record | 1 |
| Philadelphia, US | 1 |
| New Haven, US | 1 |
| Mississippi State, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Dekalb, US | 1 |
120 institutions · 4 824 of 5 210 vouchered records shown · 344 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Pimpinella major was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.4 °C 5.90–17.4
Seasonal swing summer↔winter14.7 °C
Max temp (day)19.6 °C 8.90–21.3
Min temp (night)12.6 °C 2.80–13.8
Precipitation82.2 mm/mo 56.0–89.7
Air humidity62.2 % 60.1–64.1
Moisture balance-36.9 mm/mo -73.8–28.1
Vapour deficit733 Pa 337–799
Wind speed3.80 m/s 2.60–5.30
Cloud cover43.4 % 40.4–55.8
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.