Pimelea cracens

Rye · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records115

Data sources5

Biological traits23

DNA specimens2

eDNA detections4

Sources5 archives

Databases and archives Pimelea cracens's data was compiled from.

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Leaf length14 mm

Leaf width4 mm

Plant height1.5 m

Plant height max1.5 m

Plant height min0.4 m

Seed mass4.61 mg

Seed mass max4.61 mg

Seed mass min4.61 mg

Life cycle & reproduction3

Flowering timennnnnnyyyyyy

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea cracens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSGQ205203.1 ↗616 bp

ACGT

GCGGAAGGATCATTGTCGAATCCTGCTGGCAGCACAACCCGTGAATCCGTAATCAAAATGTGTCGAGTTTGGCGGTGCCGTAAGGTCCAT …

Pimelea cracens subsp. cracens internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor4

Museum / vouchered111

Origin

Native1

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 38≤1 km 1≤10 km 38

77 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	98
BGPAlocation not on record	6
Kew, GB	2
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1
Taipei, TW	1
Canberra, AU	1
Palmerston, AU	1

8 institutions · 111 of 111 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Pimelea cracens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)