Pimelea cornucopiae

M.Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records416

Data sources4

Biological traits17

DNA specimens0

eDNA detections3

Sources4 archives

Databases and archives Pimelea cornucopiae's data was compiled from.

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Leaf length23.5 mm

Leaf width6.75 mm

Plant height0.3 m

Life cycle & reproduction3

Flowering timenyyyyyynnnnn

Life formannual

Life spanannual

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub

Leaf compoundnesssimple

Leaf shapenarrowly_obovate narrowly_ovate

Woodinesswoody

⚠ sources differ — AusTraits: woody · GIFT: non-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea cornucopiae has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSFJ572744.1 ↗338 bp

ACGT

AATCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTAGGGCCGAGGGCACGC …

Thecanthes cornucopiae 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type416 records

Wild obs. + sensor49

Museum / vouchered302

Other65

Origin

Native11

Range

Area of Occupancy AOO1 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 14≤1 km 7≤10 km 1>10 km 3

25 georeferenced · 24 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 103≤1 km 25≤10 km 109>10 km 49

286 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence302

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	160
Museo Entomologico de Leonlocation not on record	47
Canberra, AU	34
Smithfield, AU	24
Mount Annan, AU	9
James Cook Townsvillelocation not on record	8
Palmerston, AU	7
Saint Louis, US	2
Adelaide, AU	2
Honolulu, US	1
Claremont, US	1
Kensington, AU	1

12 institutions · 296 of 302 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Pimelea cornucopiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)