Pimelea ciliata

Rye · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records65

Data sources6

Biological traits22

DNA specimens0

eDNA detections3

Sources6 archives

Databases and archives Pimelea ciliata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Pimelea ciliata foliage Pimelea ciliata, commonly known as white banjine, is a species of flowering plant in the family Thymelaeaceae. It is a small shrub with white flowers and is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length15 mm

Leaf width4.25 mm

Plant height1 m

Plant height max1 m

Plant height min0.3 m

Seed mass2.91 mg

Life cycle & reproduction4

Flowering timennnnnnnyyyyy

Life formsubshrub or shrub

Life spanperennial

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_obovate ovate

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea ciliata has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSFJ572737.1 ↗619 bp

ACGT

GCGGAAGGATCATTGTCGAATCCTGCATGGCAGCACAACCCGTGAATCCTTAATCAAAATGTGTCGAGTTGGAGCGGTGCCGCAAGGTCC …

Pimelea ciliata subsp. ciliata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor42

Museum / vouchered23

Origin

Native3

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 30≤1 km 2≤10 km 1

33 georeferenced · 9 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 1≤1 km 3≤10 km 9

13 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	5
Adelaide, AU	5
Museo Entomologico de Leonlocation not on record	3
Mount Annan, AU	3
Kew, GB	2
Canberra, AU	2
Palmerston, AU	2
Hobart, AU	1

8 institutions · 23 of 23 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pimelea ciliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)