Pimelea axiflora

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records380

Data sources5

Biological traits41

DNA specimens3

eDNA detections6

Sources5 archives

Databases and archives Pimelea axiflora's data was compiled from.

GBIFGlobal Biodiversity Information Facility380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF380 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology18

Fruit length3.5 mm

Leaf length60 mm

Leaf length max60 mm

Leaf length min5 mm

Leaf mass per area91.83 g/m2

Leaf size31.44 mm²

Leaf width10 mm

Leaf width max10 mm

Leaf width min2 mm

Petiole length0.3 cm

Plant height3 m

Plant height max3 m

Plant height min0.2 m

Seed length2.5 mm

Seed mass2.51 mg

Seed mass max2.51 mg

Seed mass min2.51 mg

Seed width2.5 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnyyyyyyy

Life formsubshrub or shrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical linear oblong

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)415 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.14 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea axiflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSKX179677.1 ↗295 bp

ACGT

CATCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGT …

Pimelea axiflora subsp. axiflora voucher MEL2354862 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type380 records

Wild obs. + sensor379

Museum / vouchered1

Range

Area of Occupancy AOO944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 218≤1 km 42≤10 km 31>10 km 10

301 georeferenced · 78 without coordinates

Open the mapobservation + sensor379

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
LDlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Pimelea axiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)