Pimelea argentea

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records374

Data sources6

Biological traits23

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Pimelea argentea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF374 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pimelea argentea, commonly known as silvery leaved pimelea, is a species of flowering plant in the family Thymelaeaceae and is endemic to the south-west of Western Australia. It is an erect shrub with densely hairy young stems and leaves, the leaves linear to elliptic, and heads of white to yellow or greenish flowers, the male and female flowers on separate plants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length25.5 mm

Leaf width6 mm

Plant height1.8 m

Plant height max2 m

Plant height min0.4 m

Seed mass1.28 mg

Seed mass max1.28 mg

Seed mass min1.28 mg

Life cycle & reproduction3

Flowering timennnnnnyyyyyn

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical linear

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea argentea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAM162490.1 ↗728 bp

ACGT

GCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA …

Pimelea argentea 5.8S rRNA gene, ITS1 and ITS2, specimen voucher M. Hislop & M. Griffths WW 111.39 (PERTH)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type374 records

Wild obs. + sensor71

Museum / vouchered303

Origin

Native14

Range

Area of Occupancy AOO1 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 47≤1 km 11>10 km 3

61 georeferenced · 10 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 37≤1 km 15≤10 km 170>10 km 25

247 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	178
Museo Entomologico de Leonlocation not on record	52
Canberra, AU	20
Adelaide, AU	19
Mount Annan, AU	13
Brisbane, AU	7
BGPAlocation not on record	5
Kew, GB	4
Guangzhou, CN	2
LDlocation not on record	2
Hobart, AU	1

11 institutions · 303 of 303 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pimelea argentea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)