Pimelea angustifolia

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records643

Data sources5

Biological traits25

DNA specimens3

eDNA detections3

Sources5 archives

Databases and archives Pimelea angustifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility643 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF643 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length18 mm

Leaf width3 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.2 m

Plant height max1 m

Plant height min0.1 m

Life cycle & reproduction8

Dispersal typeanimal+self

Flowering timeynnnnnnyyyyy

Life formsubshrub or shrub

Life spanperennial

Lifespan years6 years

Pollination syndromeinsect

Reproductive maturity1.5 years

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea angustifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSFJ572726.1 ↗593 bp

ACGT

GCGGAAGGATCATTGTCGAATCCTGCATGGCAGCACAACCCGTGAATCCGTAATTAAAATGTGTTGAGTTTGAGCGGTGCCGCAAGGTCC …

Pimelea angustifolia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type643 records

Wild obs. + sensor60

Museum / vouchered583

Origin

Native32

Range

Area of Occupancy AOO2 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 34≤1 km 7≤10 km 7>10 km 6

54 georeferenced · 6 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 76≤1 km 10≤10 km 280>10 km 57

423 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence583

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	343
Museo Entomologico de Leonlocation not on record	83
Canberra, AU	51
Adelaide, AU	42
Mount Annan, AU	33
BGPAlocation not on record	14
Brisbane, AU	8
Hobart, AU	2
MAlocation not on record	2
Kew, GB	1
EL PASO, US	1
Saint Louis, US	1
Palmerston, AU	1
LDlocation not on record	1

14 institutions · 583 of 583 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pimelea angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)