Pimelea alpina

F.Muell. ex Meisn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records1 459

Data sources7

Biological traits36

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Pimelea alpina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 459 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF1 459 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pimelea alpina, the alpine rice-flower, is a species of flowering plant in the family Thymelaeaceae and is endemic to south-eastern continental Australia. It is an erect, prostrate or spreading shrub or undershrub with narrowly elliptic leaves crowded at the ends of branches and heads of pinkish red or white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length3.5 mm

Leaf length10 mm

Leaf length max10 mm

Leaf length min4 mm

Leaf mass per area97.95 g/m2

Leaf size8.04 mm²

⚠ sources differ — TRY: 8.04 mm² · AusTraits: 15.39 mm²

Leaf width4 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height0.225 m

⚠ sources differ — AusTraits: 0.225 m · TRY: 0.102 m

Plant height max0.3 m

Seed mass2.61 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timeyyynnnyyyyyy

Life formsubshrub

Life span>50

⚠ sources differ — TRY: >50 · AusTraits: perennial · GIFT: perennial

Lifespan years50 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)376 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.23 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea alpina has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSKX179691.1 ↗299 bp

ACGT

CGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGT …

Pimelea alpina voucher MEL2289194 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 459 records

Wild obs. + sensor1 219

Museum / vouchered237

Cultivated / captive3

Origin

Native52

Range

Area of Occupancy AOO1 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 940≤1 km 124≤10 km 78>10 km 5

1 147 georeferenced · 72 without coordinates

Open the mapobservation + sensor1 219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 22≤1 km 47≤10 km 93>10 km 47

209 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence237

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	73
Mount Annan, AU	52
Canberra, AU	48
Adelaide, AU	13
La Trobe Universitylocation not on record	10
John T. Waterhouse Herbariumlocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	6
Hobart, AU	6
Brisbane, AU	6
Parkville, AU	4
Armidale, AU	3
Kew, GB	2
Kensington, AU	2
Wollongong, AU	2
Stockholm, SE	1
MeiseBGlocation not on record	1
University of Alberta Museumslocation not on record	1

17 institutions · 237 of 237 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pimelea alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pimelea alpina

At a glance

Sources7 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

At a glance

Record type1 459 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 459 records