Pimelea aeruginosa

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Pimelea

At a glance

Occurrence records137

Data sources6

Biological traits20

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Pimelea aeruginosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pimelea aeruginosa is a species of small shrub in the family Thymelaeaceae. It is a small shrub with yellow flowers and is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length14.5 mm

Leaf width5 mm

Plant height0.85 m

Plant height max1.5 m

Plant height min0.2 m

Life cycle & reproduction3

Flowering timennnnnyyyyynn

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_obovate narrowly_ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pimelea aeruginosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSFJ572729.1 ↗248 bp

ACGT

GCGGAAGGATCATTGTCGAATCCTGCATGGCAGCAAACCCGTGAATCGTAATCAAAATGTGTCGAGTTTGAGCGGTGCCGCAAGGTCCCA …

Pimelea aeruginosa internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor8

Museum / vouchered129

Origin

Native1

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 1

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 18≤1 km 5≤10 km 69>10 km 5

97 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	84
Museo Entomologico de Leonlocation not on record	15
Canberra, AU	14
Adelaide, AU	7
BGPAlocation not on record	6
Brisbane, AU	1
Mount Annan, AU	1
Hobart, AU	1

8 institutions · 129 of 129 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Pimelea aeruginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)