Pilosocereus pusillibaccatus

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records11

Data sources5

Biological traits1

DNA specimens1

eDNA detections0

Sources5 archives

Databases and archives Pilosocereus pusillibaccatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility11 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF11 records

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climateseasonally dry tropical

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus pusillibaccatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOP188755.1 ↗472 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Pilosocereus pusillibaccatus isolate L15A3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor2

Museum / vouchered9

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidade Federal do Rio Grande do Nortelocation not on record	6
Museu Paraense Emílio Goeldilocation not on record	1
UFSCarlocation not on record	1
Brasília, BR	1

4 institutions · 9 of 9 vouchered records shown