Pilosocereus pentaedrophorus

(Labour.) Byles & G.D.Rowley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records92

Data sources9

Biological traits12

DNA specimens2

eDNA detections0

Sources9 archives

Databases and archives Pilosocereus pentaedrophorus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF92 records

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Pilosocereus pentaedrophorus ist eine Pflanzenart in der Gattung Pilosocereus aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton pentaedrophorus bedeutet ‚fünf Flächen tragend‘. Trivialnamen sind „Facheiro“, „Facheiro Fino“ und „Mandacarú de Veado“.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max15 m

Life cycle & reproduction2

Life formsucculent shrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

Habitat GIFTCaatinga (stricto sensu), Campo Rupestre, Carrasco, Floresta Estacional Decidual

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus pentaedrophorus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSOP188779.1 ↗438 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Pilosocereus pentaedrophorus isolate S77A20 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pilosocereus pentaedrophorus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · iapt

CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 30

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Wild obs. + sensor11

Museum / vouchered81

Origin

Native37

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1≤1 km 3≤10 km 3

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 81 records without

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFBAlocation not on record	13
Universidade Federal do Rio Grande do Nortelocation not on record	10
Laboratorio de Ictiologialocation not on record	8
Cruz das Almas, BR	6
Universidade Federal do Vale do São Franciscolocation not on record	6
CEPLAClocation not on record	6
Kew, GB	6
Bronx, US	5
JBRJlocation not on record	5
USP-IBlocation not on record	3
UFSCarlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Salvador, BR	2
Universidade Federale do Rio Grande do Sullocation not on record	2
UFPElocation not on record	1
UNICAMPlocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
Universidade Federal de Sergipe (UFS)location not on record	1
UFSClocation not on record	1

19 institutions · 81 of 81 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)