Pilosocereus machrisii

(E.Y.Dawson) Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records80

Data sources9

Biological traits14

DNA specimens5

eDNA detections0

Sources9 archives

Databases and archives Pilosocereus machrisii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF80 records

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Pilosocereus machrisii ist eine Pflanzenart in der Gattung Pilosocereus aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton machrisii ehrt Maurice A. Machris (Los Angeles, USA), nach dem auch die sogenannte Machris Expedition 1956 in Zentralbrasilien benannt wurde.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max3 m

Life cycle & reproduction2

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max700 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTCampo Rupestre, Carrasco, Cerrado (lato sensu)

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus machrisii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSOP188757.1 ↗471 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Pilosocereus machrisii isolate L18A1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lennoa madreporoidessame order3.3%Ipomoea batatassame order4.5%Panax quinquefoliussame order4.8%Jasminum sambacsame order4.8%Lobelia cardinalissame order6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pilosocereus machrisii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 17

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type80 records

Wild obs. + sensor38

Museum / vouchered41

Fossil1

Origin

Native24

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 18≤1 km 7≤10 km 2>10 km 6

33 georeferenced · 5 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFSCarlocation not on record	16
Bronx, US	6
UnBlocation not on record	5
JBRJlocation not on record	4
Brasília, BR	3
Kew, GB	2
Uberlândia, BR	1
Universidade Federal do Rio Grande do Nortelocation not on record	1
USP-IBlocation not on record	1
UFSClocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1

11 institutions · 41 of 41 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)